-
Plasmid#205532PurposeExpress HIV GagZip-MCP-dpol-P2A-eGFPDepositorInsertGag-MCP-dpol
UseTagsExpressionMammalianMutationNucleocapsid replaced with leucine zipper, pol fr…PromoterCMVAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP Δgag/pol
Plasmid#101343PurposeDeletion from the start of gag until 229 bases before the cPPTDepositorInsertNL4-3
UseLentiviralTagsExpressionMutationdelta GagPolPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
gS gag LV
Plasmid#12327DepositorInsertgag/pol
UseLentiviralTagsExpressionMammalianMutationThe CypA binding region of the WT gag was replace…PromoterAvailable sinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
gB gag LV
Plasmid#12328DepositorInsertgag/pol
UseLentiviralTagsExpressionMammalianMutationThe CypA binding region of the WT gag was replace…PromoterAvailable sinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
MMLVgag-3NES-Cre
Plasmid#207252PurposeGeneration of CreVLPs when used in conjunction with MMLV gag-pol during productionDepositorInsertMMLVgag-3NES-Cre
UseTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-TRAC-miniGag
Plasmid#228960PurposeminiEDV production plasmid. Expresses the miniGag polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
UseTagsExpressionMammalianMutationDeleted polymerase coding sequencePromoterAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BIC-Gag-DDX3
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianMutationPromoterhCMVAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-TRAC-miniGag-Cas9
Plasmid#228959PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only