-
Plasmid#50373PurposeExpress C-terminally triple HA tagged human PGAP3 in mammmalian cellsDepositorInsertPGAP3 post-GPI attachment to proteins 3 (PGAP3 Human)
UseTags3x HAExpressionMammalianMutationPromoterSR alphaAvailable sinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-PRGRH-Nluc
Plasmid#158608PurposePlasmid expressing PRG(RH)-Nluc in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - PDZ RhoGEF RH domain - linker (GGTGGS) - Nluc
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-p115RH-Nluc
Plasmid#158607PurposePlasmid expressing p115(RH)-Nluc in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - p115RhoGEF RH domain - linker (GGTGGS) - Nluc
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
BII-C3H2B
Plasmid#133387PurposePiggybac vector for SRIRACCHA-mediated mutation enrichment (surrogate target for HDR)DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpyDock
Plasmid#124618PurposeExpresses SpyDock to bind SpyTag non-covalently for affinity purificationDepositorInsertSpyDock
UseTagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCGN-ATF6 (1-373)
Plasmid#27173PurposeFor mammalian expression of the cytoplasmic domain of human ATF6with an HA tag.DepositorInsertATF6 (ATF6 Human)
UseTagsHAExpressionMammalianMutationContains only aa 1-373 (please see depositor comm…PromoterAvailable sinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2GPI
Plasmid#203759PurposeEncodes the fluorescent protein mEos3.2 followed by the C-terminal sequence derived from CD58 encoding a GPI-attachment signal. Used as a fluorescent plasma membrane probe.DepositorInsertCD58 c-term (CD58 Human)
UseTagsmEos3.2ExpressionMammalianMutationPromoterAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 c-SRC (1-249)
Plasmid#42204DepositorInsertc-SRC (1-249) (SRC Human)
UseTagsHAExpressionMammalianMutationcontains amino acids 1-249PromoterCMVAvailable sinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 c-SRC (1-397)
Plasmid#42205DepositorInsertc-SRC (1-397) (SRC Human)
UseTagsHAExpressionMammalianMutationcontains amino acids 1-397PromoterCMVAvailable sinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 c-SRC (91-536)
Plasmid#42206DepositorInsertc-SRC (91-536) (SRC Human)
UseTagsExpressionMammalianMutationcontains amino acids 91-536PromoterCMVAvailable sinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MTS-CA-c-Src-FLAG
Plasmid#44654DepositorInsertv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC) (SRC Human)
UseTagsFLAG tag and mitochondria-targeting sequence (MTS…ExpressionMammalianMutationchanged Tyr 530 to PhePromoterCMV promoterAvailable sinceMay 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MTS-KD-c-Src-FLAG
Plasmid#44653DepositorInsertv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC) (SRC Human)
UseTagsFLAG tag and mitochondria-targeting sequence (MTS…ExpressionMammalianMutationchanged lysine 298 to methioninePromoterCMV promoterAvailable sinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-KB-1753-Nluc I9A/W10A
Plasmid#158604PurposePlasmid expressing KB-1753-Nluc I9A/W10A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker(GIKLGG) - KB1753 I9A/W10A - linker (GGTGGS) - Nluc
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-GRK2RH-Nluc L118A
Plasmid#158606PurposePlasmid expressing GRK2(RH)-Nluc L118A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - GRK2 RH domain L118A - linker (GGTGGS) - Nluc
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA03
Plasmid#172194PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattR
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 GATA1 K137R
Plasmid#85694PurposeMammalian expression of mouse GATA1 with K137R mutationDepositorInsertGATA1 (Gata1 Mouse)
UseTagsExpressionMammalianMutationK137R (SUMO-1 attachment site)PromoterCMVAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET41SIII-ATF6(1-373)
Plasmid#171074PurposeExpresses of ATF6α(1-373) in bacteriaDepositorInsertATF6α (ATF6 Human)
UseTagsGST and HisExpressionBacterialMutationPromoterT7 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -