-
Plasmid#46369DepositorInsertcalretinin promoter (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMutationpromoterPromoterAvailable sinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
UseTagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
HEL binding scFv D44.1
Plasmid#111718PurposeYeast Surface Display of D44.1 as a reference starting point for designDepositorInsertD44.1
UseTagscmyc tagExpressionYeastMutationPromoterAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-1
Plasmid#8878DepositorInsertHox A9 (HOXA9 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_PIG_3XHA-Ago1
Plasmid#170916PurposeExpresses 3X-HA-AGO1DepositorInsertAgo1 (Ago1 Mouse)
UseTags3X-HAExpressionMammalianMutationPromoterAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-3
Plasmid#8880DepositorInsertHox A9 (HOXA9 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 C548A
Plasmid#126592PurposeExpresses siRNA resistant SENP2 (catalytic dead) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationC548APromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_115mut
Plasmid#73068Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (SNORD27 Human)
UseTagsno tagExpressionMammalianMutationexpression cassette for SNORD27 with AS box from …PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-Rpb1-linker
Plasmid#138468PurposeExpresses GST-tagged Rpb1 linker in bacteriaDepositorInsertRpb1 (POLR2A Human)
UseTagsGSTExpressionBacterialMutationAmino acids 1460-1585PromotertacAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQLink-GST-4xCTD
Plasmid#138471PurposeExpresses GST-tagged 4xCTD heptapeptide repeat in bacteriaDepositorInsertRpb1 (POLR2A Human)
UseTagsGSTExpressionBacterialMutation4x CTD repeatPromoterT5Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack shALAS-1
Plasmid#22748DepositorInsertshALAS-1 (Alas1 Mouse)
UseAdenoviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-mu24-ORF24-2xStrep
Plasmid#138453PurposeExpresses mu24-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorInsertmu24-ORF24 (ORF24 MHV68/KSHV)
UseTagsStrepExpressionMammalianMutationmu24 amino acids 1-191 fused to ORF24 amino acids…PromoterCMVAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Alt AlphaPS3
Plasmid#14070DepositorInsertDrosphila Alt Alpha PS3 Integrin (scb Fly)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPSt_35Spr-GFP-t35S
Plasmid#203592PurposeFully assembled Plant STARR-seq plasmid with the 35S terminator.DepositorInsertsCaMV 35S promoter + Zm00001d041672 5'UTR
eGFP
CaMV 35S terminator
UseTagsExpressionPlantMutationPromoterAvailable sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEXP(FLAG/HA-NSP1-K164-H165A)
Plasmid#188782PurposeExpresses FLAG/HA-NSP1-K164-H165A in mammalian cells (SARS-CoV-2 mutant NSP1)DepositorInsertFLAG/HA-NSP1-K164-H165A (SARS-CoV-2)
UseFrt site to insert into hek293 t-rex genomeTagsFLAG/HAExpressionMammalianMutationChanged Lysine 164 to Alanine and Histidine 165 t…PromoterCMV Dox inducibleAvailable sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein with Nluc tagged E2
Plasmid#215699PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-NLucE2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-NLucE2-6K-E1
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only