-
Plasmid#164656Purposefor the synthesis of zebrafish tal1 mRNADepositorInserttal1 (tal1 Zebrafish)
UseMrna synthesisTagsExpressionMutationPromoterSP6Available sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF1511
Plasmid#143512PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertSTAT5A (STAT5A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-Rpb4/7
Plasmid#138484PurposeExpresses GST-tagged Rpb4 and His-tagged Rpb7 in bacteriaDepositorUseTags6xHis and GSTExpressionBacterialMutationPromotertacAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN, F124D
Plasmid#180648PurposeLentiviral expression vector for SPASTIN. Has F124D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-44.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, F124D mutation, has siRNA resistan…PromoterAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Flag-PolB(K244A/T304I)-Puro
Plasmid#177144PurposeLentiviral vector expressing Flag-PolB(K244A/T304I) and a puromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
CIAR_pcDNA5/FRT/TO
Plasmid#86502PurposeExpresses CIAR in mammalian cells. Used to generate Flp-In stables.DepositorInsertCIAR (SOS1 Human)
UseFrtTagsExpressionMammalianMutationT968L in SOScatPromoterCMV (tet operator)Available sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV:: HA-hM4Dnrxn
Plasmid#52525PurposeExpresses N-terminal HA tagged hM4DnrxnDepositorInsertHA-hM4Dnrxn (CHRM4 Synthetic, Human)
UseTagsHAExpressionBacterial and MammalianMutationPromoterCMVAvailable sinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pBW_0001
Plasmid#102833PurposeBinary vector containing Sr22 Schomburgk allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorInsertSr22 Schomburgk (NEWENTRY Synthetic)
UseTagsExpressionPlantMutationPromoterMaize ubiquitinAvailable sinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO-1: shALAS-1
Plasmid#22750DepositorInsertshALAS-1 (Alas1 Mouse)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
TFORF1510
Plasmid#144365PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertSTAT5A (STAT5A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.1
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1A
Plasmid#196679PurposeRep/Cap plasmid for the production of MDV1A, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRSVGSVY insert between amino acids 588 and 589 of…Promoterp41Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack: shRev-Erbalpha
Plasmid#22749DepositorInsertshRev-Erbalpha (Nr1d1 Mouse)
UseAdenoviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceJune 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
UseTagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only