-
Plasmid#202347PurposeDesign opt.a (greedy optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.a
UseTagsExpressionMutationPromoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.b_pSTC0-zeo
Plasmid#202348PurposeDesign opt.b (parallel tempering optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.b
UseTagsExpressionMutationPromoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
UseTagsExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_052
Plasmid#216082Purposefor stable fly cell lines; Hygromycin resistance gene; for genome integration by spontaneous insertion, destination vectorDepositorHas ServiceCloning Grade DNAInsertHygromycin resistance gene
UseDestinationTagsExpressionInsectMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVTagsExpressionMammalianMutationPromoterhPGK1Available sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
ptAD-seq-ubi63E-Gal4-DBD
Plasmid#111930PurposeVector to express tAD candidates from a library cloned from fragmented transcription factor coding sequences fused to the Gal4 DNA binding domain.DepositorInserttAD-seq Gal4-DBD
UseTagsExpressionInsectMutationPromoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantMutationPromoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP793_L2_V05_s35S_AND_GFP_pOp6_Flp_CO2_B3
Plasmid#192397PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when its AND gate unit is activated by both cell type (cortex) and chemical induction (by DEX).DepositorInsert35S::FRT-OCS-FRT::B3RT-OCS-B3RT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-npas4l
Plasmid#164654Purposefor the synthesis of zebrafish npas4l mRNADepositorInsertnpas4l (npas4l Zebrafish)
UseMrna synthesisTagsExpressionMutationPlease see depositor commentsPromoterSP6Available sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-etsrp
Plasmid#164655Purposefor the synthesis of zebrafish etsrp mRNADepositorInsertetsrp (etsrp Zebrafish)
UseMrna synthesisTagsExpressionMutationPromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_15278a
Plasmid#173545PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_15278_P17777
UseTagsExpressionPlantMutationPromoter35SAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorInsertPolBgRNA1 (POLB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-llo190-mc38minor
Plasmid#174604Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes Aatf, irgq and cpne1DepositorInsertpalmitoyl-GFP C-term fusion LLO190 and minigenes of 3 neoantigens from MC38 tumor in genes Aatf irgq cpne1
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_14371
Plasmid#173567PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_14371_T30-4
UseTagsExpressionPlantMutationPromoter35SAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_11947
Plasmid#173566PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_11947_T30-4
UseTagsExpressionPlantMutationPromoter35SAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_07558
Plasmid#173565PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_07558_T30-4
UseTagsExpressionPlantMutationPromoter35SAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL86977OD:PITG_23226
Plasmid#173564PurposeThis is a binary plasmid that can be transferred into Agrobacterium and used to transiently express the protein encoded by the insert in plants by agro-infiltration.DepositorInsertPITG_23226_T30-4
UseTagsExpressionPlantMutationPromoter35SAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only