We narrowed to 27,300 results for: GFP
-
Plasmid#158059PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the forward orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP FAK Y397F
Plasmid#50516PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorInsertprotein tyrosine kinase, mutated
TagsGFPExpressionMammalianMutationY397FPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSico-CAG-v-H-Ras-IRES-Luciferase/EGFP
Plasmid#58959Purposelentiviral expression of v-H-Ras and luciferase/EGFP reporterDepositorInsertsCMV enhancer/chicken beta actin promoter
v-H-Ras
luc2/EGFP fusion gene
UseLentiviralExpressionMammalianPromoterCMV enhancer/chicken beta actinAvailable sinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoFlipped-CAG-GFP-2A-DGCR8-WPRE-bGHpA
Plasmid#231021PurposeFor lentivirus-mediated co-expression of GFP and DGCR8DepositorAvailable sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pF147 pSOD1A4VAcGFP1
Plasmid#26408DepositorPublicationAvailable sinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plv-AcGFP-SOD1 (G93A)
Plasmid#27142DepositorPublicationAvailable sinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pF142 pAcGFP1 SOD1 A4V
Plasmid#26403DepositorPublicationAvailable sinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 hSyn1-Lck-GFP
Plasmid#177333PurposeExpresses GFP on the plasma membrane of neurons via an Lck localization sequenceDepositorInsertLck-GFP
UseAAVTagsGFPExpressionBacterialPromoterhSyn1Available sinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-N2-PKCgamma
Plasmid#21204DepositorInsertPKC gamma (Prkcg Rat)
TagsGFPExpressionMammalianMutationPKC gamma (rat). (Lab plasmid WC 0013)Available sinceJuly 15, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NOVA1 eGFP
Plasmid#61275PurposeGFP-tagged ORF clone of Homo sapiens neuro-oncological ventral antigen 1 (NOVA1), transcript variant 1DepositorAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCEFL EGFP-TEADi
Plasmid#140144PurposeTEAD inhibitor (TEADi): GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal.DepositorInsertEGFP TEADi
TagsEGFPExpressionMammalianPromoterEF1aAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Actb KI
Plasmid#183429PurposeCreOFF knock-in for GFP-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-GFPEnvy-SpHis5
Plasmid#60782PurposeYeast C-terminal tagging vector, which creates gene fusions with GFPEnvy using SpHis5 selectionDepositorInsertGFPEnvy
UseYeast integratingMutationS30R Y39N T65C S72A F99S N105T Y145F M153T V163A …Available sinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mini-donor - NKX6.1-nEGFP
Plasmid#206047Purposethis mini-donor knockin vector can be used to knock nuclear EGFP into NKX6.1 locusDepositorInsertnuclear EGFP
Available sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMPRA3-CMV-Clover
Plasmid#53540PurposeFluorescent reporter control for pMPRA3DepositorInsertClover GFP
ExpressionMammalianPromoterCMV IEAvailable sinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pST_116_LVL2 cam
Plasmid#179332PurposeNT-CRISPR plasmid for a single gRNA.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRAvailable sinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only