We narrowed to 27,337 results for: GFP
-
Plasmid#61294PurposeMammalian expression of GFP-alpha-SSeCKSDepositorAvailable sinceDec. 9, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pFIN-EF1a-GFP-WPRE
Plasmid#44352DepositorInsertEF1a-GFP
UseLentiviralPromoterhuman elongation factor -1a (pos 2526-3969)Available sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-GRET
Plasmid#158222PurposeControl lentiviral plasmid encoding GFP-Nluc BRET reporter from Schaub et al., Cancer Research, 2015.DepositorInsertGFP-Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Lifeact_Halo_T2A_EGFP
Plasmid#135445PurposeMamalian cell expression of HaloTag7 localized at F-actin and cytosolic EGFPDepositorInsertLifact-HaloTag7 and EGFP
TagsLifactExpressionMammalianPromoterCMV/TetOAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
eGFP L202 gRNA
Plasmid#119132PurposegRNA that guides Cas9 and APOBEC complexes to L202 in eGFP.DepositorInserteGFP L202 gRNA
UseCRISPRMutationNonePromoterU6Available sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-mMALAT1_3' WT Sense
Plasmid#46834PurposeExpress cGFP transcript ending in the wildtype MALAT1 triple helixDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable sinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPfor
Plasmid#158059PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the forward orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-(pos15)GFP
Plasmid#89248Purpose[Edit] Expresses GFP with +15 theoretical charge in E.ColiDepositorInsertHis6-(pos15)-GFP
TagsHis6ExpressionBacterialPromoterT7Available sinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGFP FAK Y397F
Plasmid#50516PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorInsertprotein tyrosine kinase, mutated
TagsGFPExpressionMammalianMutationY397FPromoterCMVAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSico-CAG-v-H-Ras-IRES-Luciferase/EGFP
Plasmid#58959Purposelentiviral expression of v-H-Ras and luciferase/EGFP reporterDepositorInsertsCMV enhancer/chicken beta actin promoter
v-H-Ras
luc2/EGFP fusion gene
UseLentiviralExpressionMammalianPromoterCMV enhancer/chicken beta actinAvailable sinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoFlipped-CAG-GFP-2A-DGCR8-WPRE-bGHpA
Plasmid#231021PurposeFor lentivirus-mediated co-expression of GFP and DGCR8DepositorAvailable sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 hSyn1-Lck-GFP
Plasmid#177333PurposeExpresses GFP on the plasma membrane of neurons via an Lck localization sequenceDepositorInsertLck-GFP
UseAAVTagsGFPExpressionBacterialPromoterhSyn1Available sinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pF147 pSOD1A4VAcGFP1
Plasmid#26408DepositorPublicationAvailable sinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
plv-AcGFP-SOD1 (G93A)
Plasmid#27142DepositorPublicationAvailable sinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pF142 pAcGFP1 SOD1 A4V
Plasmid#26403DepositorPublicationAvailable sinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCEFL EGFP-TEADi
Plasmid#140144PurposeTEAD inhibitor (TEADi): GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal.DepositorInsertEGFP TEADi
TagsEGFPExpressionMammalianPromoterEF1aAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-N2-PKCgamma
Plasmid#21204DepositorInsertPKC gamma (Prkcg Rat)
TagsGFPExpressionMammalianMutationPKC gamma (rat). (Lab plasmid WC 0013)Available sinceJuly 15, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only