-
Plasmid#225173PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (GmR).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pHBJT016
Plasmid#225167PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (ChlR).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT015
Plasmid#225166PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (ChlR).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT018
Plasmid#225169PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (AmpR).DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_accNAT_GWB
Plasmid#154033PurposeGateway cloning into T. pseudonana or C. cryptica episomal vectorDepositorTypeEmpty backboneUseDiatom cloningTagsExpressionMutationPromoterAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE2 EGFP
Plasmid#129435Purposeexpress GFPDepositorInsertGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+TA
Plasmid#49338PurposepCS2+ vector with MCS replaced by a TA-cloning linkerDepositorInsertTA-cloning linker containing EGFP
UseGateway compatible cloning vectorTagsExpressionMutationPromoterAvailable sinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pME-TA
Plasmid#49337PurposeMiddle entry vector with TA-cloning linkerDepositorInsertTA-cloning linker containing EGFP
UseGateway cloning vectorTagsExpressionMutationPromoterAvailable sinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST-attB
Plasmid#30325DepositorInsertphiC31 attB site
UseDrosophila transgenesisTagsExpressionMutationPromoterAvailable sinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMT316
Plasmid#8608DepositorInsertbarstar
UseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pENTR R4-eGFP-R3
Plasmid#32312DepositorInserteGFP
UseGateway multisite entry cloneTagsExpressionMutationPromoterAvailable sinceSept. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pENTR R4-mCherry-R3
Plasmid#32311DepositorInsertmCherry
UseGateway multisite entry cloneTagsExpressionMutationPromoterAvailable sinceSept. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-MCS-WPRE-UbC-MCS
Plasmid#211798PurposeLentiviral vector plasmid containing a multiple cloning site (MCS) under the spleen focus-forming virus (SFFV) promoter and another multiple cloning site (MCS) under the Ubiquitin C (UbC) promoterDepositorInsertsmultiple cloning site
multiple cloning site
UseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDL1
Plasmid#182263PurposeGibson cloning vector for synthesis of single and double stranded RNADepositorTypeEmpty backboneUseGibson cloning vector for synthesis of single and…TagsExpressionMutationPromoterT3 and SP6 for sense and antisense riboprobe synt…Available sinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBJT031
Plasmid#225177PurposeLow copy cloning vector with mCherry integrated in the multiple cloning site (AmpR). There is a SmaI immediately upstream of mCherry start codon, which allows for C-terminal mCherry fusions.DepositorTypeEmpty backboneUseSynthetic BiologyTagsmCherryExpressionBacterialMutationPromoterAvailable sinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT034
Plasmid#225180PurposeLow copy cloning vector with mCherry integrated in the multiple cloning site (SmR). There is a SmaI immediately upstream of mCherry start codon, which allows for C-terminal mCherry fusions.DepositorTypeEmpty backboneUseSynthetic BiologyTagsmCherryExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT032
Plasmid#225178PurposeLow copy cloning vector with mCherry integrated in the multiple cloning site (TetR). There is a SmaI immediately upstream of mCherry start codon, which allows for C-terminal mCherry fusions.DepositorTypeEmpty backboneUseSynthetic BiologyTagsmCherryExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT033
Plasmid#225179PurposeLow copy cloning vector with mCherry integrated in the multiple cloning site (GmR). There is a SmaI immediately upstream of mCherry start codon, which allows for C-terminal mCherry fusions.DepositorTypeEmpty backboneUseSynthetic BiologyTagsmCherryExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT030
Plasmid#225176PurposeLow copy cloning vector with mCherry integrated in the multiple cloning site (Chlr). There is a SmaI immediately upstream of mCherry start codon, which allows for C-terminal mCherry fusions.DepositorTypeEmpty backboneUseSynthetic BiologyTagsmCherryExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only