-
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107578PurposeB. megaterium DSM319 fbp promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic BiologyTagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfbp promoter Bacillus megaterium DSM319Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXN1
Plasmid#101445PurposeDonor Vector containing FOXN1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXN1 (FOXN1 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TH0901-pOCC177-FUS-wt_opt(Nhe)
Plasmid#221885PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationwtPromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1259-014_Jie_EWSR1_pOCC119_pOEM1-N-HIS6-MBP-NotI-AscI-C-TEV-mGFP
Plasmid#221894PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertEWSR1 (EWSR1 Human)
UseTags6xHis-MBP-PreScission and TEV-mGFPExpressionInsectMutationwtPromoterPH promoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA6
Plasmid#101418PurposeDonor Vector containing GATA6 transcription factor, part of the Human TFome CollectionDepositorInsertGATA6 (GATA6 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC6A4_STOP
Plasmid#161338PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC6A4 (SLC6A4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-FOXQ1
Plasmid#101628PurposeDonor Vector containing FOXQ1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXQ1 (FOXQ1 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES3
Plasmid#101411PurposeDonor Vector containing HES3 transcription factor, part of the Human TFome CollectionDepositorInsertHES3 (HES3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
TH1274-054_Jie_EWSR1_pOCC177_pOEM1-N-HIS-MBP-PS-NotI-AscI-TEV-SNAP
Plasmid#221896PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertEWSR1 (EWSR1 Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationwtPromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH0994-pOCC177-Fus-wt_(1-211)
Plasmid#221886PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationPLD domain (aa 1-211)PromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1148-pOCC177-FUS(Nhe)-PLD_YtoF
Plasmid#221887PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F)PromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1149-pOCC177-FUS(Nhe)-RGG_RtoK
Plasmid#221888PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn RGG (aa 212-526) most of Arg (R) changed to Ly…PromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1202-pOCC175_pOEM1-N-HIS-MBP-PS-mGFP-TEV-HNRNPA3_opt
Plasmid#221890PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertHNRNPA3 (HNRNPA3 Human)
UseTags6xHis-MBP-PreScission-mGFP-TEVExpressionInsectMutationwtPromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXI3
Plasmid#101518PurposeDonor Vector containing FOXI3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXI3 (FOXI3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only