-
Plasmid#124042PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing spdCas9 fused to tagBFP P2A tagBFP, and an sgRNA targeting pTRE expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-spdCAS9::tagBFP-P2A-tagBFP-SV40PA_mu6-sgTRE_pTRE-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB365
Plasmid#124048PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to mRuby2 P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::mRuby2-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV2-ITR-pEFS-NLS_hfCas13d(RfxCas13d_N2V8)_FLAG_NLS-pA-U6-DR-Pcsk9-sg5-DR-Pcsk9-sg6-DR-AAV2-ITR
Plasmid#191795Purposevector for encoding and AAV packaging a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by EFS promoter, Pcsk9-target guide RNAs compatible with RfxCas13d driven by hU6DepositorInserthumanized hfCas13d
UseAAV and CRISPRTagsExpressionMammalianMutationA134V, A140V, A141V, A143VPromoterEFS, hU6Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-GFPg1 (BB09)
Plasmid#139461PurposeLentiviral vector with gRNA targeting GFP; includes puromycin selectable markerDepositorInsertGFP-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN244 - CTCF-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
Plasmid#92140PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using BLASTICIDIN selection. Auxin-inducible degron system.DepositorInsertAID[71-114]-eGFP
UseMouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg2
Plasmid#139451PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg1
Plasmid#139450PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK0_047
Plasmid#123977PurposeEncodes the Cas9 hCLYBL homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthCLYBL CAS9 Destination - HygroR
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-CTRLg1 (CG509)
Plasmid#139455PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-CTRLg2 (CG510)
Plasmid#139456PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6-LSL (Cre dependent)Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
MTK0_004
Plasmid#123961PurposeEncodes the Cas9 cROSA26 homology destination with Blasticidin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInsertcRosa26 destination
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#120799PurposeE. coli-C. difficile shuttle vector for xylose-inducible expression in C. difficile; Pxyl driving expression of red fluorescent protein (mCherryOpt)DepositorInsertPxyl::mCherryOpt
UseTagsExpressionBacterialMutation1.4 kb xylR-Pxyl DNA fragment from C. difficile R…PromoterPxylAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN396 - pCAGGS-Tir1-V5-2A-PuroR TIGRE donor
Plasmid#92142PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection (2A-fusion). Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN114 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt-Rosa26
Plasmid#92143PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only