-
Plasmid#58920Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T821 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with T821 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S807
Plasmid#58918Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S807 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S807 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T826
Plasmid#58921Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T826 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with T826 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S249
Plasmid#58908Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S249 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S249 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S612
Plasmid#58914Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S612 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S612 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-EcoCas6
Plasmid#106274PurposeEncodes E.coli CRISPR Type I-E CasE with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertEcoCasE
UseCRISPRTagsFlag, NLSExpressionMammalianMutationPromoterCMVAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S608
Plasmid#58913Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S608 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S608 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-LmoCas6-KRAB-2a-BlastR
Plasmid#126492PurposeEncodes lentivirus expression of L. monocytogenes CRISPR Type I-B Flag-Cas6-KRAB-2a-BlastR driven by hUbC promoterDepositorInsertLmoCas6-KRAB-2a-BlastR
UseCRISPR and LentiviralTagsFlag, NLSExpressionMammalianMutationPromoterhUbCAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-EcoCas8e
Plasmid#106270PurposeEncodes human codon optimized E.coli CRISPR Type I-E CasA with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertEcoCasA
UseCRISPRTagsFlag, NLSExpressionMammalianMutationPromoterCMVAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-EcoCse2
Plasmid#106271PurposeEncodes human codon optimized E.coli CRISPR Type I-E CasB with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertEcoCasB
UseCRISPRTagsFlag, NLSExpressionMammalianMutationPromoterCMVAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-EcoCas7
Plasmid#106272PurposeEncodes human codon optimized E.coli CRISPR Type I-E CasC with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertEcoCasC
UseCRISPRTagsFlag, NLSExpressionMammalianMutationPromoterCMVAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-EcoCas5
Plasmid#106273PurposeEncodes human codon optimized E.coli CRISPR Type I-E CasD with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertEcoCasD
UseCRISPRTagsFlag, NLSExpressionMammalianMutationPromoterCMVAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRb delta CDK + S230
Plasmid#58907Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S230 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S230 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T252
Plasmid#58910Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T252 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with T252 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
YAF2_pLX307
Plasmid#98383PurposeLentiviral expression of YAF2DepositorInsertYAF2 (YAF2 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterE1FaAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
TLK1_pLX307
Plasmid#98378PurposeLentiviral expression of TLK1DepositorInsertTLK1 (TLK1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterE1FaAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWzl_neo_DEST_flag_PIK3CA
Plasmid#45308DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsFlagExpressionMammalianMutationPromoterAvailable sinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_ARPM1
Plasmid#45259DepositorInsertARPM1 (ACTRT3 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationPromoterAvailable sinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3UTR
Plasmid#202550PurposeReady for cloning and heterologous expression of genes in mammalian cells with protein export to cultivation mediaDepositorTypeEmpty backboneUseTagsATG initiation codon followed by an IGKV3 signal …ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only