-
Plasmid#183886PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorInsertMYH10 sgRNA spacer (MYH10 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ARB347
Plasmid#124030PurposeEncodes TU with connectors L1 R2 and an B1 insulator, and pCMV expressing cytoplasmic mRuby2DepositorInsertL1-B1_CMV-NES::mRuby2-rglPA_R2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK4a_010
Plasmid#123823PurposeEncodes a nuclear localized mRuby2 coexpression cassette as a Type 4a part to be used in the MTK systemDepositorInsertT2A::NLS::mRuby2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK4a_021
Plasmid#123834PurposeEncodes a nuclear localized and destabilized mRuby2 coexpression cassette as a Type 4a part to be used in the MTK systemDepositorInsertT2A::NLS::mRuby2::PEST4d
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_032
Plasmid#123746PurposeEncodes JNK Translocation Reporter (JNK KTR) fused to mRuby2 as a Type 3 part to be used in the MTK systemDepositorInsertJNKKTR-mRuby2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-JNKAR
Plasmid#181857PurposeGenetically encoded FRET-based sensor for monitoring JNK kinase activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-JNKAR
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-EKAR
Plasmid#181858PurposeGenetically encoded FRET-based sensor for monitoring ERK activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-EKAR
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ECT2_sgRNA
Plasmid#183875PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorInsertECT2 sgRNA spacer (ECT2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-AKAR
Plasmid#181844PurposeGenetically encoded FRET-based sensor for monitoring PKA activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-AKAR
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianMutationPromoterEF1aAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
UseTagsExpressionYeastMutationPex22(1-36)PromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
UseTagsExpressionYeastMutationPex22(1-36)PromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-ICUE
Plasmid#181845PurposeGenetically encoded FRET-based sensor for monitoring cAMP dynamics near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-ICUE (RAPGEF3 Human)
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-FbLAG16
Plasmid#220749PurposeNIR-FbLAG16 expression in mammalian cells. pAAV vector.DepositorInsertNIR-FbLAG16
UseAAV and Affinity Reagent/ AntibodyTagsExpressionMutationPromoterCAGAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NIR-FbLAG30
Plasmid#220750PurposeNIR-FbLAG30 expression in mammalian cells. pAAV vector.DepositorInsertNIR-FbLAG30
UseAAV and Affinity Reagent/ AntibodyTagsExpressionMutationPromoterCAGAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only