-
Plasmid#65776PurposeHuman expression vector for S aureus Cas9: CAG-humanSaCas9-NLS-3xFLAGDepositorInsertmammalian codon-optimized Staphylococcus aureus Cas9-NLS-3xFlag
UseCRISPRTagsNLS-3xFLAGExpressionMammalianMutationPromoterCAGAvailable sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET32a-TRXtag
Plasmid#11516DepositorInsertNone - thioredoxin is vector encoded (trxA )
UseTagsHis, His (out of frame), and TrxExpressionBacterialMutationvector modified; removed N-terminal His tag by di…PromoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
PB-Aka-P2A-GFP
Plasmid#120867PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertAkaluc
UseTagsExpressionMammalianMutationinsert Akaluc and a P2A sitePromoterCAG PromoterAvailable sinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-Antares2
Plasmid#120868PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertpcDNA3-Antares2
UseTagsExpressionMammalianMutationAntares2 ampliconPromoterCAG PromoterAvailable sinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP1594
Plasmid#65775PurposeHuman expression vector for S. thermophilus 1 Cas9: CAG-humanSt1Cas9-NLSDepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS
UseCRISPRTagsNLSExpressionMammalianMutationPromoterCAGAvailable sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPH-T2A-GFP-shP53
Plasmid#102895PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPH-T2A-GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-PYL-DNMT1-NEO)
Plasmid#114396PurposeFor PYL-DNMT1 expressionDepositorInsertPYL-DNMT1
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAIP-hXRCC1pd-eGFP
Plasmid#206033PurposeMammalian expression of PAR-deficient hXRCC1pd coupled to eGFP under the control of a CAG promoterDepositorInserthXRCC1
UseTagseGFPExpressionMammalianMutationS103A,R186A,S184A,S193A,S219A,S220A,S236A,S268APromoterCAGAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
p55-H2B-Dendra2
Plasmid#80609PurposeEncodes H2B-Dendra2-fusion protein under the CAG promoter. Linearize using Asc1 and Not1 for mouse embryo injection.DepositorInsertH2B-Dendra2 (H2BC21 Human, Synthetic)
UseTagsDendra2ExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-RPG
Plasmid#85931PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-NHEJ. Puro-T2A-EGFP
UseDual-reporter surrogateTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPPH-T2A-GFP-shP53
Plasmid#102897PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPPH-T2A-GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSSA-RPG
Plasmid#85932PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-SSA. Puro-T2A-EGFP
UseDual-reporter surrogateTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only