We narrowed to 3,478 results for: ttl
-
Plasmid#126971PurposeLevel 1 vector. sfGFP reporter. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pMGA-ptac-sfGFP
Plasmid#139934PurposeIPTG-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertLacI-Ptac-sfGFP
ExpressionBacterialAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pST-Ki
Plasmid#44563Purposefor integrative constitutive expression of mycobacterial proteinsDepositorTypeEmpty backboneUseE.coli-mycobacteria shuttle vectorTagsFlag tag and His tagExpressionBacterialAvailable SinceOct. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCL66-decoder
Plasmid#159453PurposeInsert: Pfus1mut-tetR-nls-malE-tCyc1. Same insert as pCL33-decoder in a multiple integration shuttle vector. Backbone: pRG235 (addgene). Marker: Leu2.DepositorInsertPfus1mut-tetR-nls-malE-tCyc1
UseSynthetic BiologyExpressionYeastPromoterPfus1mutAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBM3
Plasmid#225290PurposeE. coli-Campylobacter shuttle vector; KanRDepositorInsertReplication elements from pCC388 for pJBM3
ExpressionBacterialAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD69m2-AphA
Plasmid#191247PurposeE. coli - Eggerthella lenta shuttle plasmid with kanamycin resistance in E. lentaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMZ4004
Plasmid#204401PurposeA 3OHC14-HSL sensor for B. subtilis on a shuttle vector for B. subtilis and E. coli.DepositorInsertsmCinR
GFP
UseSynthetic BiologyPromoterPftsH and Synthetic promoter PCin0102DAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP44-2A(sfGFP)
Plasmid#126988PurposeLevel 2 vector. sfGFP reporter. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaB-msfYFPBb
Plasmid#118233PurposeGentamicin-resistant E.coli/B. burgdorferi shuttle vector; Encodes flagellin promoter driven msfYFPDepositorInsertflagellin promoter driven msfYFP
ExpressionBacterialAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXD69m1-TetW
Plasmid#191246PurposeE. coli - Eggerthella lenta shuttle plasmid with tetracycline resistance in E. lentaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ265_OoA3GX2
Plasmid#225147PurposeGateway entry clone (attL1 & attR5) OoA3GX2-CBE_V01 for C-T base editingDepositorInsertOoA3GX2-zCas9(D10A)-UGI
ExpressionPlantAvailable SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMGA-ptet-sfGFP
Plasmid#139935PurposeaTc-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertTetR-Ptet-sfGFP
ExpressionBacterialAvailable SinceJuly 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaB-mCeruleanBb
Plasmid#118235PurposeGentamicin-resistant E.coli/B. burgdorferi shuttle vector; Encodes flagellin promoter driven mCeruleanDepositorInsertflagellin promoter driven mCerulean
ExpressionBacterialAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJYDNgp
Plasmid#162453PurposePositive control plasmid for pJYDNg carrying the eUnaG2 bilirubin dependent fluorescent protein fused to the C-terminus of Aga2p protein. This plasmid contains a long 2G linker.DepositorInsertAga2p-2Glinker-eUnaG2 (AGA2 )
UseShuttle vector bacteria/yeastTagsHA nad myc and eUnaG2 fluorescent proteinPromoterGAL1Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCL-ReDNAP (Y427A)
Plasmid#52346PurposeCEN6/ARS4 plasmid, REV1 promoter>Recoded TP-DNAP1 (Y427A)DepositorInsertRecoded TP-DNAP
ExpressionBacterial and YeastPromoterREV1Available SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOCC82
Plasmid#118862Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for untagged recombinant proteinDepositorInsertNcoI-NotI-ccdB-AscI-stop-HindIII cassette
ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGB
Plasmid#139932PurposeM. magneticum/E. coli shuttle vector (partial sequence of pMGT and p15A)DepositorInsertsfGFP
ExpressionBacterialPromoterPJ23101Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEINO5
Plasmid#179489PurposeMulti-host shuttle plasmid for E. coli, D. radiodurans, and S. cerevisiae; contains an oriT for transfer via conjugationDepositorInsertaacC1
UseSynthetic Biology; Bacterial and yeast cloningAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAP72_MS2
Plasmid#220623PurposeCassette vector to enable overexpression of rNTases as MS2 coat protein fusions in S. cerevisiae.DepositorTypeEmpty backboneUseShuttle vectorExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only