Showing: 2381 - 2400 of 6451 results
-
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha1
Plasmid#165858PurposeAlpha1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha2
Plasmid#165859PurposeAlpha2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega1
Plasmid#165860PurposeOmega1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega2
Plasmid#165861PurposeOmega2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pR6Kg-Alpha2
Plasmid#165863PurposeAlpha level R6K_ origin GB Cloning vector, Conditionally replicative ori, requires pir gene expression requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived) uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pR6Kg-Omega2
Plasmid#165865PurposeOmega level R6K_ origin GB Cloning vector, Conditionally replicative ori, requires pir gene expression requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived) uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pR6Kg-Alpha1spm
Plasmid#165866PurposeModified Alpha level R6K_ origin GB Cloning vector, Conditionally replicative ori, requires pir gene expression requires pir gene expression requires EC100D or EC100D116 bacterial strain (DH10B derived) uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-sfGFP-GMRWhite
Plasmid#165907PurposeBlasticidin resistant 5xUAS sfGFP GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-mCherry-GMRWhite
Plasmid#165908PurposeBlasticidin resistant 5xUAS mCherry GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-sfGFP-MiniWhite
Plasmid#165910PurposeBlasticidin resistant 5xUAS sfGFP Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-mCherry-MiniWhite
Plasmid#165911PurposeBlasticidin resistant 5xUAS mCherry Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xUAS-EBFP2-MiniWhite
Plasmid#165912PurposeBlasticidin resistant 5xUAS EBFP2 Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable UAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-12xLexAOp-sfGFP-MiniWhite
Plasmid#165916PurposeBlasticidin resistant 12xLexAOp sfGFP Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable LexAOp Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-12xLexAOp-mCherry-MiniWhite
Plasmid#165917PurposeBlasticidin resistant 12xLexAOp mCherry Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable LexAOp Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-12xLexAOp-EBFP2-MiniWhite
Plasmid#165918PurposeBlasticidin resistant 12xLexAOp EBFP2 Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable LexAOp Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-mCherry-GMRWhite
Plasmid#165920PurposeBlasticidin resistant 5xQUAS mCherry GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-EBFP2-GMRWhite
Plasmid#165921PurposeBlasticidin resistant 5xQUAS EBFP2 GMR-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBlastR-5xQUAS-sfGFP-MiniWhite
Plasmid#165922PurposeBlasticidin resistant 5xQUAS sfGFP Mini-White CDS response vector. Contains an Alpha level GB2.0 entry point for addition of custom assemblies utilizing blue-white bacterial colony screeningDepositorInsertSelectable QUAS Response Vector
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 2381 - 2400 of 6451 results