-
Plasmid#41930DepositorInsertBRD7 (BRD7 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTRAAK
Plasmid#224765PurposeIn vitro transcription for Oocyte expression of mTRAAKDepositorInsertPotassium channel subfamily member 4 (Kcnk4 Mouse)
UseIn vitro transcription for oocyte expressionTagsExpressionMutationPromoterT7Available sinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX307-VHL(C162F)-3F-BirA
Plasmid#220149PurposeExpresses VHL(C162F)-BirA as a control for VHL substrate identification by E-STUBDepositorInsertvon Hippel-Lindau tumor suppressor (VHL Human)
UseLentiviralTags3F-BirAExpressionMammalianMutationchanged cysteine 162 to phenylalanine; codon opti…PromoterEF-1aAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX307-VHL(Y98H)-3F-BirA
Plasmid#220148PurposeExpresses VHL(Y98H)-BirA as a control for VHL substrate identification by E-STUBDepositorInsertvon Hippel-Lindau tumor suppressor (VHL Human)
UseLentiviralTags3F-BirAExpressionMammalianMutationchanged tyrosine 98 to histidine; codon optimizedPromoterEF-1aAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
UseTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
UseTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp1
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
UseTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL0_AC-27877
Plasmid#202110PurposeLevel 0 plasmid containing the promoter from gene 27877 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert27877 promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove sapI sites fo…PromoterAvailable sinceAug. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CE-OriT
Plasmid#202150PurposeLevel 0 plasmid containing an origin of transfer sequence from pPtPBR11 required for making plasmids mobilizable for conjugation with CE overhangs used to build level 1 constructs.DepositorInsertOrigin of transfer
UseSynthetic BiologyTagsExpressionMutationOriT sequence mutated to remove sapI sites domest…PromoterAvailable sinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove bsaI site for…PromoterAvailable sinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove bsaI site for…PromoterAvailable sinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove sapI sites fo…PromoterAvailable sinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove sapI site for…PromoterAvailable sinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove bsaI site for…PromoterAvailable sinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove sapI sites fo…PromoterAvailable sinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyTagsExpressionMutationPromoter sequence mutated to remove bsaI sites fo…PromoterAvailable sinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_tKiMBImut-T2A-caMEK
Plasmid#199579PurposeExpress tKiMBImut(AA) and caMEK in an AAV vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
constitutively active MEK
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPR promoter and PLTetO-1Available sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v2-hu6-sgCebpd_v2
Plasmid#177254PurposeExpresses Cebpa_v2 (mU6), Cebpd_v2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpd_v2
UseLentiviralTagsExpressionMutationPromotermU6/hU6Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only