-
Plasmid#106315PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorInsertsgRNA targeting mShmt2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT2_2
Plasmid#106310PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_1
Plasmid#106316PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
APq5210
Plasmid#66086Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-CLTC
Plasmid#227312PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of CLTC for knock-in.DepositorArticleInsertsgRNA Targeting C-terminus of CLTC (CLTC Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorArticleInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU67Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorArticleInsertsgRNA Targeting C-terminus of PEX3 (PEX3 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR-USR-SpCas9
Plasmid#208829PurposeHDR Universal Surrogate Reporter with a sgRNA and consistently expressed SpCas9. The PuroR reporter gene was designed to be repaired as a selecting marker gene only by the sgRNA/Cas9-triggered HDR.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterEF-1a; U6Available sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterEF-1a; U6Available sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0760
Plasmid#185629PurposeModified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T (BsaI-domesticated) which targets phytoene desaturase (PDS) of Nicotiana benthamianaDepositorInsertsgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0751
Plasmid#185628PurposeModified tobacco rattle virus RNA2 acceptor vector that could be used for expression of sgRNAs, contains restriction enzyme sites for golden gate assembly using BsaIDepositorInsertlacZ
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralTagsExpressionMutationPromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleInsertIDH2 sgRNA #7 (IDH2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleInsertIDH1 sgRNA #4 (IDH1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only