-
Plasmid#163795PurposeExpresses SlutrCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only
-
ShaCas9
Plasmid#163794PurposeExpresses ShaCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
B-eSpCas9
Plasmid#126761PurposeExpression plasmid for human codon-optimized increased fidelity Blackjack-eSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than eSpCas9.DepositorInsertB-eSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A; K1003A; R1060A; amino acids 1005-1013 repl…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-evoSpCas9
Plasmid#126765PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-evoSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than evoSpCas9.DepositorInsertB-evoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V; Y515N; K526E; R661Q; amino acids 1005-1013…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9
Plasmid#126760PurposeExpression plasmid for human codon-optimized Blackjack-SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of WT SpCas9.DepositorInsertB-SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationamino acids 1005-1013 replaced with two glycinePromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_CNRZ1066
Plasmid#136651PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:CNRZ1066 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:CNRZ_1066 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_MTH17CL396
Plasmid#136656PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:MTH17CL396 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HypaSpCas9
Plasmid#126763PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HypaSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HypaSpCas9.DepositorInsertB-HypaSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN692A; M694A; Q695A; H698A; amino acids 1005-1013…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_TH1477
Plasmid#136655PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:TH1477 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMG18311
Plasmid#136653PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD9:LMG18311 chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW-Cas9-Blast
Plasmid#83481PurposeLentiviral vector for mammalian expression of doxycycline-inducible Cas9 and constitutive expression of Blasticidin S deaminase -T2A -rtTADepositorInsertsSpCas9
Blasticidin S deaminase -T2A - reverse tetracycline-controlled transactivator
UseCRISPR and LentiviralTagsExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterTight Tre and human phosphoglycerate kinase 1 pro…Available sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry empty
Plasmid#80975PurposeCas9, mCherry, and sgRNA expressionDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMB1-A-ptet-dCas9
Plasmid#190129PurposeLevel 1 MoClo plasmid containing an aTC inducible dCas9 for CRISPRiDepositorInsertdCas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMB1-A-pBAD-dCas9
Plasmid#190132PurposeLevel 1 MoClo plasmid containing an arabinose inducible dCas9 for CRISPRiDepositorInsertdCas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-BFP empty
Plasmid#80976PurposeCas9, TagBFP, and sgRNA expressionDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorInsertTh (Th Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorInsertFaah (Faah Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
UseTagsExpressionMammalianMutationPromoterPhCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJWV102-PL-dCas9
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRTagsExpressionBacterialMutationPromoterPLspAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP791_PB_dCas9-SSSavi_BirA
Plasmid#211786PurposePiggyBac plasmid with dCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), and BirA, with Hygro selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
UseTags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpCAGG abd pEF1aAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-scFv
Plasmid#78900PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cellsDepositorInsertscFV-VP64
UseCRISPRTagsGFPExpressionInsectMutationPromoterpActin (Drosophila)Available sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorInsertSaCas9 gRNA targeting Yap1 (Yap1 Mouse)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA1
Plasmid#99734PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorInsertSaCas9 gRNA targeting Yap1 (Yap1 Mouse)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-Frame +1
Plasmid#66940PurposeCRISPaint frame selector +1DepositorInsertgRNA frame +1
UseTagsExpressionMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-Frame +2
Plasmid#66941PurposeCRISPaint frame selector +2DepositorInsertgRNA frame +2
UseTagsExpressionMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-Frame +0
Plasmid#66939PurposeCRISPaint frame selector +0DepositorInsertgRNA frame +0
UseTagsExpressionMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-SpCas9
Plasmid#85450PurposeExpress SpCas9 in mammalian cellsDepositorInsertpRSV
UseAAVTagsExpressionMutationPromoterpRSVAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-VRQR-P2A-EGFP (KAC1309)
Plasmid#185913PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9-VRQR(D10A/D1135V/G1218R/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-VRQR-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-VRQR=D10A/D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-nSpCas9-VRQR-P2A-EGFP (KAC1166)
Plasmid#185918PurposepCMV and pT7 plasmid encoding human codon optimized ABE8.20m A-to-G base editor with nickase SpCas9-VRQR(D10A/D1135V/G1218R/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8.20m-nSpCas9-VRQR-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-VRQR=D10A/D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9
Plasmid#184464PurposePlasmid encoding PRDM9-Cas9 fusion under CMV promoterDepositorInsertPRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
UseTagsNLS(SV40)-3xFLAGExpressionMammalianMutationPromoterCAGAvailable sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
IF311: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-LSD1
Plasmid#121824PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IF405: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-p300core
Plasmid#121825PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/p300core (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IA304: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-VPR
Plasmid#121822PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IB801: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-KRAB
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
UseTagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available sinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_ABE7.10_St1Cas9_LMD9
Plasmid#136660PurposeExpresses ABE St1Cas9 LMD9 in mammalian cells along with its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
ABE7.10
UseCRISPR and Synthetic BiologyTagsSV40 NLS and hSt1Cas9ExpressionMammalianMutationPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide1
Plasmid#118158PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCBh-ABE8e-nSpCas9(D10A)[N-term] (HES1468)
Plasmid#197509PurposeCbh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-nSpCas9(D10A)DepositorInsertAAV-[ITR]-pCBh-BPNLS-TadA8e-nSpCas9(D10A)[N-term]-NpuN-BPNLS-[ITR]
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSExpressionMutationABE8e mutations in TadA and nSpCas9(D10A)PromoterCbhAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-Tet1-CD
Plasmid#83340PurposeTo introduce dCas9-fused Tet1-CD and sgRNA2.0 systemDepositorInsertdCas9-Tet1-CD and sgRNA scaffold with 2xMS2 binding sites
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterU6, CBHAvailable sinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only