-
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1415
Plasmid#84828PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-HOIL-1 full-length (1–510)
Plasmid#193858PurposeExpression of human His-tagged HOIL-1 (RBCK1) full-length (1–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationCodon optimised for expression in E. coliPromoterT7Available sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Synthetic, Human)
UseTags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Synthetic, Human)
UseTags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationContains the V65I mutation that increases discrim…PromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBad-sfGFP
Plasmid#85482PurposeArabinose inducible E. coli codon optimized superfolder GFP with C-terminal His6 tagDepositorInsertsuperfolder GFP
UseTags6x HisExpressionBacterialMutationPromoterArabinoseAvailable sinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP wild type
Plasmid#174075PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP with C-terminal His6 tag, under T7 promoterDepositorInsertSuperfolder GFP
UseTagsHis-6ExpressionBacterialMutationPromoterT7Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP-150TAG
Plasmid#174076PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP-150 TAG with C-terminal His6 tag, under T7 promoter,DepositorInsertSuperfolder GFP
UseTagsHis-6ExpressionBacterialMutationN150TAGPromoterT7Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Blast
Plasmid#52962PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.DepositorHas ServiceLentiviral PrepInsertsCas9
Blasticidin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PE-bacteria
Plasmid#172715PurposeExpression of an E. coli codon optimized fusion protein of Cas9n-linker-M-MLV2 for prime editingDepositorInsertCas9n-linker-M-MLV2
UseTagsExpressionBacterialMutationH840A of Cas9PromoterAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-APOBEC1-YTH
Plasmid#200158PurposeFor bacterial expression of the APOBEC1-YTH fusion protein for protein purificationDepositorInsertAPOBEC1-YTH
UseTags6xHis, HA, and Maltose Binding ProteinExpressionBacterialMutationCodon optimized for E coli expressionPromoterLacZAvailable sinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS-L1PA1-CH-mneo
Plasmid#51288Purposecontains the fully codon optimized ORF1 and ORF2 of the human L1RPDepositorInsertL1 (L1RE1 Human)
UseTagsmneoI indicator cassette containing an inverted n…ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDD282
Plasmid#66823PurposeGFP^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertGFP-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized GFPExpressionWormMutationPromoterAvailable sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDD268
Plasmid#132523PurposemNG^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmNG-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized mNGExpressionWormMutationPromoterAvailable sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only