Showing: 2001 - 2020 of 4601 results
-
Plasmid#207316PurposeMammalian expression of Zika virus PrME proteinDepositorInsertZIKV_PrME (POLY Zika virus)
UseTagsExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailabilityAcademic Institutions and Nonprofits only -
pHCMV_ALV_Env
Plasmid#207325PurposeExpression of env polyprotein from Avian leukosis virus (ALV)DepositorInsertALV_Env (env Avian leukosis virus)
UseTagsExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailabilityAcademic Institutions and Nonprofits only -
pHCMV_EIAV_Env
Plasmid#207326PurposeExpression of env polyprotein from equine infectious anaemia (EIAV)DepositorInsertEIAV_Env
UseTagsExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-TrxF
Plasmid#207454PurposeE. coli expression of Mesembryanthemum crystallinum Thioredoxin F with thrombin-cleavable N-terminal 6xHis tagDepositorInsertThioredoxin F
UseTags6xHisExpressionBacterialMutationCodon optimized for E coli expressionPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
-
pMSSM24: pCMV-SpuFz1
Plasmid#205260PurposeHuman expression vector for human codon optimized SpuFz1DepositorInsertSpuFz1
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pMJ326: pCMV-GtFz1
Plasmid#205264PurposeHuman expression vector for human codon optimized GtFz1DepositorInsertGtFz1
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pMJ329: pCMV-MmeFz2
Plasmid#205266PurposeHuman expression vector for human codon optimized MmeFz2DepositorInsertMmeFz2
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYPQ300
Plasmid#205414PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Ev1Cas12a without promoterDepositorInsertEv1Cas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLS (N terminal on insert) NLS (C terminal on ins…ExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYPQ301
Plasmid#205415PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Hs1Cas12a without promoterDepositorInsertHs1Cas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas3
Plasmid#209427PurposePlasmid for CASCADE-Cas3 based genome engineering of streptomycetesDepositorInsertcodon optimized minimal type I-C CASCADE-Cas3 from Pseudomonas aeruginosa
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPtipA; crRNA under control of PermE*AvailabilityAcademic Institutions and Nonprofits only -
FLAG-hLRP6-opt(20-1613)-9xHis_MESD_pFastBacDual
Plasmid#216377PurposeBaculovirus transfer vector to co-express FLAG-LRP6-His (human sequence, codon-optimized for insect cell expression) and MESD chaperone (human sequence)DepositorInsertLDL receptor related protein 6 (LRP6 Human)
UseBaculovirusTags9xHis and HA signal sequence-FLAG-3C cleavage sit…ExpressionInsectMutationPromoterPolyhedrin (LRP6)/p10 (MESD)AvailabilityAcademic Institutions and Nonprofits only -
pCM4.4
Plasmid#217648Purposean ermE*p-cas9-driven expression, as an alternative plasmidDepositorInsertCodon Optimized SpCas9
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
pCFJ1137
Plasmid#84827PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1415
Plasmid#84828PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1955
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
UseTagsExpressionBacterial and WormMutationPromoterPeft-3AvailabilityAcademic Institutions and Nonprofits only
Showing: 2001 - 2020 of 4601 results