-
-
shh10
Plasmid#64867PurposeThis plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the engineered shh10 capsid protein.DepositorInsertshh10 cap
UseAAVTagsExpressionMutationI319V, N451D, D532NPromoterAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorInsertshRNA targetting Hmga2 (Hmga2 Mouse)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 ShhN
Plasmid#37680DepositorInsertshh (Shh Mouse)
UseTagsExpressionMammalianMutationsoluble form (see comments)PromoterCMVAvailable sinceJuly 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX_sgRNA_entry (CJT32)
Plasmid#181782PurposeExpresses ShHELIX containing a nicking I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOEM1_pCMV:hShh-pPH:vsvged
Plasmid#111156PurposeBaculovirus rescue vector, VSVGED pseudotype, hShhDepositorInserthShh (SHH Human)
UseBaculoviral rescue shuttle vectorTagsExpressionInsect and MammalianMutationwtPromoterCMVAvailable sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
UseTagsExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga1#3
Plasmid#122289PurposeKnockdown for mouse Hmga1DepositorInsertKnockdown shRNA for mouse Hmga1 (Hmga1 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga1#1
Plasmid#122288PurposeKnockdown for mouse Hmga1DepositorInsertKnockdown shRNA for mouse Hmga1 (Hmga1 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
shha-pCRII
Plasmid#68962Purposefor antisense probe, NotI w/ Sp6DepositorInsertshha (shha Zebrafish)
UseTagsExpressionMutationPromoterAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#3
Plasmid#122291PurposeKnockdown for mouse Hmga2DepositorInsertKnockdown shRNA for mouse Hmga2 (Hmga2 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSico-shHDAC2
Plasmid#194983Purposeconditional knock down HDAC2DepositorInsertshHDAC2
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22i2Shh24G4FER3(#1041)
Plasmid#184072Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2
UseZebrafish transgenesis (blue eyes)TagsExpressionMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-Shha2.4Available sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#2
Plasmid#122290PurposeKnockdown for mouse Hmga2DepositorInsertKnockdown shRNA for mouse Hmga2 (Hmga2 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-Y764_V765insHH
Plasmid#116319PurposeLentiviral expression of EGFR Y764_V765insHHDepositorInsertEGFR (EGFR Human)
UseLentiviralTagsExpressionMutationY764_V765insHHPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS hShh (CT#401)
Plasmid#13996DepositorInsertShh (SHH Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBS mShh (CT#258)
Plasmid#13999DepositorInsertShh (Shh Mouse)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only
Holiday Schedule: Addgene will be closing at 1:00 pm EST on November 27th and remain closed through the 29th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
How are we doing? Share feedback for a chance to win $50
Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more
Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more
