8,265 results
-
Plasmid#232957PurposeGalactose iduced expression of Gcn4 ILVtoED in yeastDepositorInsertGcn4 ILVtoED
TagsTEV cleavage siteExpressionYeastMutationL123D, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Swap3HA
Plasmid#232998PurposeGalactose iduced expression of Gcn4 k0.47HA in yeastDepositorInsertGcn4 k0.47
Tags3xHA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 StoL
Plasmid#232981PurposeGalactose iduced expression of Gcn4 StoL in yeastDepositorInsertGcn4 StoL
TagsTEV cleavage siteExpressionYeastMutationS104L, S117L, S136L, S144LPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WGFP
Plasmid#233007PurposeGalactose iduced expression of Gcn4 LVtoED W+GFPin yeastDepositorInsertGcn4 ILVtoED W+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R3W
Plasmid#232975PurposeGalactose iduced expression of Gcn4 R++ W+ in yeastDepositorInsertGcn4 R++ W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD103R, N126W, D133R, K143RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44mer
Plasmid#232956PurposeGalactose iduced expression of Gcn4 WT 44mer in yeastDepositorInsertGcn4 WT 44mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3HA
Plasmid#232996PurposeGalactose iduced expression of Gcn4 E+HA in yeastDepositorInsertGcn4 E+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WW+
Plasmid#232984PurposeGalactose iduced expression of Gcn4 WW+ in yeastDepositorInsertGcn4 WW+
TagsTEV cleavage siteExpressionYeastMutationE109N, S117D, T121W, N126W, T132WPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 F108A+
Plasmid#232974PurposeGalactose iduced expression of Gcn4 F108A in yeastDepositorInsertGcn4 F108A
TagsTEV cleavage siteExpressionYeastMutationF108A, T121L, A141PPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_DBDGFP
Plasmid#232999PurposeGalactose iduced expression of Gcn4 DBDGFP in yeastDepositorInsertDBD
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoAS
Plasmid#232959PurposeGalactose iduced expression of Gcn4 ILVtoAS in yeastDepositorInsertGcn4 ILVtoAS
TagsTEV cleavage siteExpressionYeastMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merGFP
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS424 Prp8 WT TRP1
Plasmid#234120PurposeThe N-terminus of Prp8 was restored thereby destroying the NheI site and correcting the ORFDepositorInsertPrp8
ExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-NFAPoptim
Plasmid#221110PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-CFAPoptim
Plasmid#221111PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221114PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Tef1 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only