-
Plasmid#199631PurposePrgef-1 GPI YFP unc-54 3' UTR C.elegans Pan-neural expression of GPI-YFPDepositorInsertGPI
UseTagsYFPExpressionWormMutationPromoterPregf-1Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
pJH2829
Plasmid#199693PurposePcex-1 tomm-20::miniSOG UrSL mCherry unc-54 3' UTR C.elegans RIM neuron expression of miniSOG RFPDepositorInsertminiSOG
UseTagsRFPExpressionWormMutationPromoterPcex-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH3830
Plasmid#200038PurposePrig-3 zif-1 SL2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of zif RFPDepositorInsertZIF (zif-1 Nematode)
UseTagsmCherryExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorInsertzif-1 (zif-1 Nematode)
UseTagsEBFPExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS110
Plasmid#215674PurposeSplit hygromycinR landing pad insertion plasmid for ChrIIIDepositorInsert5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
UseCRISPR and Cre/LoxTagsExpressionWormMutation3' ∆HYGR is promoterless and encodes aa60-341PromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxTagsExpressionWormMutation5' ∆HYGR encodes aa1-226PromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxTagsExpressionWormMutation5' ∆HYGR encodes aa1-226PromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH64 - [AFDp | gfp | tbb-2 UTR]
Plasmid#200338Purposegfp BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorUseTagsExpressionWormMutationE490GPromoterAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH50 - [PVQp | gfp | tbb-2 UTR]
Plasmid#200326Purposegfp BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00003755, nlp-17Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH47 - [ADLp | mScarlet | tbb-2 UTR]
Plasmid#200323PurposemScarlet BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | wrmscarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011644, T09B9.3Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH80 - [AWAp | gfp | tbb-2 UTR]
Plasmid#200354Purposegfp BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only