-
Plasmid#184974PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v2
UseTagsExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.111
Plasmid#184980PurposeTest effect of extending a1/a2 on TRP2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 27 v1
UseTagsExpressionYeastMutationTRP2 donor E64stop, a1/a2 length extended to 27 bpPromoterGal7Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW228-lenti-sg1-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189944PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg1-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #1
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW401-lenti-sg1-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189950PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg1-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #1
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW403-lenti-sg3-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189952PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg3-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #3
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.112
Plasmid#184981PurposeExpress -Eco1 FAA1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, FAA1 P233X, a1/a2 length: 12
UseTagsExpressionYeastMutationFAA1 donor P233stopPromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.113
Plasmid#184982PurposeTest effect of extending a1/a2 on FAA1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, FAA1 P233X, a1/a2 length: 27 v1
UseTagsExpressionYeastMutationFAA1 donor P233stop, a1/a2 length extended to 27 …PromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.002
Plasmid#184972PurposeExpress -Eco1 ADE2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 12
UseTagsExpressionYeastMutationADE2 donor P272stopPromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.110
Plasmid#184979PurposeExpress -Eco1 TRP2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 12
UseTagsExpressionYeastMutationTRP2 donor E64stopPromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.039
Plasmid#184973PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v1
UseTagsExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e7
Plasmid#190687PurposesgRNA targeting enhancer 7 of MYCDepositorInsertsgRNA targeting enhancer 7 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
UseTagsExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV162
Plasmid#188486PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTagsExpressionMammalianMutationNonePromoterU6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_3-2
Plasmid#185055PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_5-1 or TFAP4_BHLH_5-2DepositorInsertTFAP4_3_2_gRNA (Tcfap4 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA3
Plasmid#180364Purposetargeting mouse Arkadia geneDepositorInsertArkadia targeting gRNA (Rnf111 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYJ34-PB-CRISPR-BANCR-E1-gRNA
Plasmid#131077Purposelong non-coding RNA BANCR knock outDepositorInsertBANCR Exon1 gRNA (BANCR Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only