-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_FLT3
Plasmid#223566PurposeThe plasmid is expressed FLT3 in mammalian cells.DepositorInsertFLT3 wild type (FLT3 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationDeletion of F50-E275PromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryExpressionMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable sinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorInsertAquaporin 4 (AQP4 Human)
UseTagsEmGFPExpressionMammalianMutationPromoterAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX311-GFP-MEKDD
Plasmid#194882PurposeExpression of dominant negative MEK1DepositorInsertMEKDD (MAP2K1 Human)
UseLentiviralTagsExpressionMammalianMutationS218D, S222DPromoterE1FaAvailable sinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingTagsExpressionMammalianMutationPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgSEC61B.N1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216251PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgSEC61B.N1 to tag endogenous SEC61B N-terminusDepositorInsertCas9 and sgSEC61B.N1 (SEC61B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationContains the V65I mutation that increases discrim…PromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-p110 CUX1
Plasmid#100816PurposeGateway lentiviral vector expressing p100 CUX1 (amino acids 747-1505 of P39880), with an N-terminal Myc tag and a C-terminal HA tagDepositorInsertHs CUX1 amino acids 747-1505 of P39880 (CUX1 Human)
UseLentiviralTagsHA and mycExpressionMammalianMutationcontains amino acids 747-1505PromoterAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorTagsExpressionMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorInserths737 enhancer (reference sequence) (LOC110120928 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNB1-LOX
Plasmid#154058PurposeLevel 1, Position 3 Golden Gate vector. ZmUbi-5'UTR:loxP-GUS-nosT-loxP-NAM-B1-nosTDepositorInsertLoxP-flanked GUS and TtNAM-B1
UseSynthetic BiologyTagsExpressionBacterialMutationThe TtNAM-B1 gene sequence was domesticated to re…PromoterZmUbiAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only