Showing: 141 - 160 of 321 results
-
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
-
pLV_hU6-sgRNA_hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#162334PurposeLentiviral expression of dSaCas9-KRAB and a sgRNA with puromycin resistanceDepositorInsertdSaCas9-KRAB
UseLentiviralTagsHAExpressionMammalianMutationPromoterhUbCAvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1(guide_2)
Plasmid#205417PurposeMutagenesis of Ntsr1, second guideDepositorInsertNtsr1 (Ntsr1 Mouse)
UseCRISPRTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP160-pU6-sgRNA
Plasmid#158987PurposeVector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP160
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-SID4X-pU6-sgRNA
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpCMVAvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-miR122 TS
Plasmid#209783PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoter, incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertmiR122 ts
UseAAVTagsHAExpressionMutationPromotercTNTAvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNLS-SpCas9MT3-NLS-3xHA-NLS-dSaCas9-2xNLS
Plasmid#107318PurposeExpresses SpCas9 (R1335K) fused to dSaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 (R1335K) fused to nuclease dead SaCas9 (D1…PromoterCMV IE94AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNLS-SpCas9WT-NLS-3xHA-NLS-dSaCas9-2xNLS
Plasmid#107319PurposeExpresses SpCas9 fused to dSaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 is fused to nuclease dead SaCas9 (D10A, N5…PromoterCMV IE94AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNLS-SpCas9WT-NLS-3xHA-NLS-SaCas9WT-2xNLS
Plasmid#107320PurposeExpresses SpCas9 fused to SaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 is fused to SaCas9PromoterCMV IE94AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 141 - 160 of 321 results