Showing: 1481 - 1500 of 1823 results
-
Plasmid#71383PurposeExpresses scramble shRNA Cre-dependently by flex switchDepositorInserthuman synapsin promoter-flex switch-dsRed-shscramble
UseAAV, Cre/Lox, and RNAiTagsExpressionMammalianMutationPromoterhuman synapsinAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-hSOX9-1
Plasmid#40644DepositorInsertsh-hSOX9-1 (SOX9 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterhU6AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to bulged siRNA
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shWillin-A
Plasmid#40885DepositorInsertshWillin-A (FRMD6 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shWillin-B
Plasmid#40886DepositorInsertshWillin-B (FRMD6 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
shLacZ
Plasmid#42559DepositorInsertshLacZ
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pMig (Martins Lab)
Plasmid#14125DepositorInsertIRES-EGFP
UseRNAi and RetroviralTagsExpressionMammalianMutationCla I sites were silenced in the original pRetroS…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pXL002-ishRNA-beta-catenin-1
Plasmid#36297DepositorInsertshRNA of beta-catenin-1 (CTNNB1 Human)
UseLentiviral and RNAiTagsIRES-RFP-PuroExpressionMammalianMutationPromoterTetO-H1AvailabilityAcademic Institutions and Nonprofits only -
pXL003-ishRNA-beta-catenin-2
Plasmid#36299DepositorInsertshRNA of beta-catenin-2 (CTNNB1 Human)
UseLentiviral and RNAiTagsIRES-RFP-PuroExpressionMammalianMutationPromoterTetO-H1AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN1
Plasmid#52676PurposeshRNA against α-actinin-1 with eGFP transfection markerDepositorInsertACTN1 (Actn1 Rat)
UseRNAiTagsCMV-EGFPExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN2
Plasmid#52677PurposeshRNA against α-actinin-2 with eGFP transfection markerDepositorInsertACTN2 (Actn2 Rat)
UseRNAiTagsCMV-EGFPExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorInsertACTN4 (Actn4 Rat)
UseRNAiTagsCMV-EGFPExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shp38
Plasmid#52920Purposeexpresses a hairpin specific for human p38MAPKDepositorInsertshRNA targeting mitogen-activated protein kinase p38 (MAPK14 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pTER E2F1shRNA human
Plasmid#66883PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F1DepositorInsertE2F transcription factor 1 (E2F1 Human)
UseRNAiTagsExpressionMammalianMutationPromoterH1 TetAvailabilityAcademic Institutions and Nonprofits only -
pTER E2F2shRNA human
Plasmid#66884PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F2DepositorInsertE2F transcription factor 2 (E2F2 Human)
UseRNAiTagsExpressionMammalianMutationPromoterH1 TetAvailabilityAcademic Institutions and Nonprofits only -
pTER E2F3shRNA human
Plasmid#66885PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F3DepositorInsertE2F transcription factor 3 (E2F3 Human)
UseRNAiTagsExpressionMammalianMutationPromoterH1 TetAvailabilityAcademic Institutions and Nonprofits only
Showing: 1481 - 1500 of 1823 results