-
Plasmid#104037PurposeDonor vector for 3' FLAG tag of human ZNF511DepositorInsertZNF511 homology arms (ZNF511 Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMammalianMutationPromoterAvailable sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pV1338
Plasmid#111443PurposeSolo vector pV1326 + sgScADE2DepositorInsertCaCas9/sgScADE2
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pEJS1089: mini-AAV.sgRNA.Nme2Cas9
Plasmid#159536PurposeDelivery of Nme2Cas9 and its sgRNA in a single AAV vector with overall packaging size of 4.4 KbDepositorInsertNme2Cas9 with single guide RNA cassette
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianMutationPromoterU1aAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX334-U6-DR-BB-DR-Cbh-NLS-hSpCas9n(D10A)-NLS-H1-shorttracr-PGK-puro
Plasmid#42333PurposeThis plasmid separately encodes a human codon-optimized SpCas9 nickase, a tracrRNA and customizable crRNA.DepositorArticleInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationPromoterAvailable sinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRTagsExpressionMammalianMutationPromoterchick U6.3Available sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-tRNA2.0
Plasmid#158393PurposeGolden Gate entry vector to express the 1st gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B2.0
Plasmid#167158PurposeGolden Gate entry vector to express the 4th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAtU3Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE
Plasmid#112872Purposebinary vector for ABE expression in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA cassette
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-LwaCas13acrRNA-BsmBIcassette (LTH151)
Plasmid#171129PurposeLwaCas13a crRNA entry vector for pU6 expression (need to clone in spacer into BsmBI sites)DepositorInsertU6 promoter entry plasmid for LwaCas13a crRNA cloning
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135B2.0
Plasmid#167159PurposeGolden Gate entry vector to express the 5th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAtU3Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136B2.0
Plasmid#167160PurposeGolden Gate entry vector to express the 6th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAtU3Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-tRNA2.0
Plasmid#158394PurposeGolden Gate entry vector to express the 2nd gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM123: pAAV-EFS-CasRx-control presgRNA
Plasmid#166871PurposeAAV vector for expressing CasRx and control presgRNA for RNA-editingDepositorInsertsU6-control presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-tRNA2.0
Plasmid#158395PurposeGolden Gate entry vector to express the 3rd gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-tRNA2.0
Plasmid#158396PurposeGolden Gate entry vector to express the 4th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135-tRNA2.0
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136-tRNA2.0
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_792
Plasmid#216084Purposefor adding plate and well barcodes via 6-9 and 9-10 modules, destination vectorDepositorInsertfor adding plate and well barcodes via 6-9 and 9-10 modules
UseLentiviral; DestinationTagsExpressionMammalianMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only