-
Plasmid#14503DepositorInsertIQGAP1 3'UTR (IQGAP1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterAvailable sinceMarch 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
XE252 pCDNA3.1(zeo)-hDsh3-333-716
Plasmid#16757DepositorInsertFLAG-333-716-Dsh3 (DVL3 Human)
UseTagsFlagExpressionMammalianMutationaa 333-716PromoterAvailable sinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
3xFN-Tel-TAL/pMXs-puro
Plasmid#63590PurposeExpresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat. A retroviral expression vector with the puromycin resistance gene.DepositorInsert3xFVN-Tel-TAL
UseRetroviral and TALENTags3xFLAG-tag, V5-tag, and nuclear localization sign…ExpressionMammalianMutationPromoterLTRAvailable sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
XE255 pCDNA3.1(zeo)-hDsh3-truncPDZ
Plasmid#16754DepositorInsertFLAG-hDsh3-trunc before PDZ (DVL3 Human)
UseTagsflagExpressionMammalianMutationtruncated before PDZPromoterAvailable sinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMART-ala10
Plasmid#87135PurposeNADPH dependent Alanine Dehydrogenase, Low Phosphate Dependent E. coli ExpressionDepositorUseTagsExpressionBacterialMutationD196A, L197RPromoterwaaHp from E. coli as part of operon with ald* an…Available sinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
DNMT1 KO Neo
Plasmid#16649DepositorInsertDNMT1 knock-out construct (DNMT1 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2.sgNf1.4
Plasmid#92029PurposesgNf1.4 for Nf1 deletionDepositorInsertsgNf1.4 for Nf1 deletion
UseLentiviral and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.a-Fc-His
Plasmid#72120PurposeExpresses the extracellular region of the Netrin G2, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng2.a (Ntng2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC77
Plasmid#62338PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.b-Fc-His
Plasmid#72111PurposeExpresses the extracellular region of the Netrin G1, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNtng1.b (Ntng1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLINK CDK9 myc (D167N) (P#1084)
Plasmid#14637DepositorInsertcdk9 D167N (CDK9 Human)
UseTagsmycExpressionMammalianMutationD167N. Kinase negative mutant.PromoterAvailable sinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
UseTagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available sinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
XE253 pCDNA3.1(zeo)-hDsh3-82-716
Plasmid#16756DepositorInsertFLAG-82-716-Dsh3 (DVL3 Human)
UseTagsflagExpressionMammalianMutationaa 82-716PromoterAvailable sinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_1.0.1-Fc-His
Plasmid#72087PurposeExpresses the extracellular region of the NCAM1, isoform 1.0.1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNcam1_1.0.1 Mouse (Ncam1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sdk1-AP-His
Plasmid#72008PurposeExpresses the extracellular region of the Sdk1 protein (endogenous signal peptide replaced with CD33 signal peptide), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSdk1 (Sdk1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only