Showing: 11421 - 11440 of 147713 results
-
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailabilityIndustry, Academic Institutions, and Nonprofits
-
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailabilityIndustry, Academic Institutions, and Nonprofits -
BglB in pET29b(+)
Plasmid#55773PurposeExpresses beta-glucosidaseDepositorInsertBeta-glucosidase B (bglB Synthetic)
UseTags6xHisExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pcDNA3
Plasmid#55774PurposeGenetically encoded caged Ca2+DepositorInsertPACR
UseTagsmsEGFPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
UseTags6xHis and msEGFPExpressionBacterialMutationPromoterT7 promoterAvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-o-YFP
Plasmid#55776PurposeThis G protein alpha-o construct contains internal insertions of YFP and the EE epitopeDepositorInsertG protein alpha-o internally tagged with EYFP and EE epitope (Gnao1 Rat)
UseTagsEE epitope was introduced internally with D167E a…ExpressionMammalianMutationA BglII site was removed from the 5' untrans…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-gamma-2 in pcDNAI/Amp
Plasmid#55777PurposeA C-terminal CFP fragment was fused to Ggamma-2. When co-expressed with an N-terminal mCerulean, CFP, or YFP fragment fused to a Gbeta subunit with which it interacts a fluorescent signal is produced.DepositorInsertCFP(159-238)-gamma-2 (GNG2 Human, Aequorea victoria)
UseTagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
Cer(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55778PurposeA carboxyl-terminal mCerulean fragment was fused to Gbeta-5. When co-expressed with an amino terminal mCerulean fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCer(159-238)-beta-5 (GNB5 Human, Aequorea victoria)
UseTagsmCer(159-238) was fused to the amino terminus of …ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
mCherry-Mem
Plasmid#55779PurposeThis red fluorescent plasma membrane marker consists of the first twenty residues of neuromodulin fused to mCherry.DepositorInsertmCherry-Mem
UseTagsThe N-terminal 20 residues of neuromodulin are fu…ExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-o-R179C-EE
Plasmid#55780PurposeThis is a constitutively activated G protein alpha-o mutant containing an internal EE epitope.DepositorInsertG protein alpha-o with constitutively activating R179C mutation (Gnao1 Rat)
UseTagsEE epitope was introduced internally with D167E a…ExpressionBacterial and MammalianMutationArginine 179 was replaced with cysteinePromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-YFP
Plasmid#55781PurposeThis G protein alpha-s construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-s-EE YFP (Gnas Rat)
UseTagsEYFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationMet was substituted for Gln69 in EYFP (Clontech).…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-YFP
Plasmid#55782PurposeThis G protein alpha-q construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-q EE YFP (Gnaq Mouse)
UseTagsThe EE epitope was introduced into the alpha-q se…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F1
Plasmid#55784PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (1-969aa)DepositorInsert3xFLAG tagged HERC2 (1-969aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F2
Plasmid#55785PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (950-1750aa)DepositorInsert3xFLAG tagged HERC2 (950aa-1750aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F3
Plasmid#55786PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (1700-2700aa)DepositorInsert3xFLAG tagged HERC2 (1700aa-2700aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F4
Plasmid#55787PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2(2600-3600aa)DepositorInsert3xFLAG tagged HERC2 (2600-3600aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F5
Plasmid#55788PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (3550-4450aa)DepositorInsert3xFLAG tagged HERC2 (3550-4450aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA SF-HERC2 F6
Plasmid#55789PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (4421-4834aa)DepositorInsert3xFLAG tagged HERC2 (4421-4834aa) (HERC2 Human)
UseTags3xFLAG and STREPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 11421 - 11440 of 147713 results