We narrowed to 33,162 results for: crispr
-
Plasmid#203355PurposeDrug-inducible expression of CRISPRoff components needed for DNA methylation and gene repression with Sleeping Beauty backboneDepositorInsertCRISPRoff-TetOn
Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFVp-CRISPRoffv2.1-IRES-BlastR
Plasmid#207181PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by SFFV PromoterDepositorInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterSFFVpAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#1-puro
Plasmid#231979PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Px330-EGFP-LRRK2-CRISPR/Cas9
Plasmid#180437PurposePlasmid to express Cas9 from S.pyogenesand CRISPR gRNA to introduce LRRK2-G2019S mutation in human cellsDepositorAvailable SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ6332 - ACTB CRISPRa CLIP Donor
Plasmid#210015PurposeCLIP donor for integrating CRISPRa (dCas12-miniVPR)-T2A-GFP-P2A to the ACTB locusDepositorInsertdLbCpf1-miniVPR-T2A-GFP
UseLentiviralExpressionMammalianAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgCasp8_#2-puro
Plasmid#231978PurposeKnockout mouse Casp8DepositorInsertsgRNA with Cas9 with puromycin resistance (Casp8 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgCasp8_#1-puro
Plasmid#231977PurposeKnockout mouse Casp8DepositorInsertsgRNA with Cas9 with puromycin resistance (Casp8 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2
Plasmid#70658PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
Plasmid#70659PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC6 (pP18(T)_B11-AVA4069)
Plasmid#239304PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC6DepositorInsertU6-driven sgRNA targeting EXOSC6 (EXOSC6 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC7 (pP18(T)_C4-AVA4066)
Plasmid#239305PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC7DepositorInsertU6-driven sgRNA targeting EXOSC7 (EXOSC7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only