Showing: 10821 - 10840 of 20580 results
-
Plasmid#97307PurposeAAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoterDepositorInserthumanized S. pyogenes Cas9
UseAAV and Mouse TargetingTagsFlagExpressionMammalianMutationPromoterEFSAvailabilityAcademic Institutions and Nonprofits only -
Lenti_Efs_hSpCas9_NLS_FLAG-WPRE
Plasmid#97313PurposeLentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter.DepositorInserthumanized S. pyogenes Cas9
UseLentiviral and Mouse TargetingTagsFlagExpressionMammalianMutationPromoterEFSAvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiP (CRONUS-Puro)
Plasmid#100596PurposepiggyBac vector expressing Dual-regulated Cas9 (Puro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorTagsExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiH (CRONUS-Hygro)
Plasmid#100597PurposepiggyBac vector expressing Dual-regulated Cas9 (Hygro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorTagsExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_plasmid_donor_RD
Plasmid#86551PurposeHomology-directed repair (HDR) donor plasmid with homology arms to ATP1A1 to introduce the Q118R and N129D (RD) mutations conferring cellular resistance to ouabainDepositorInsertATP1A1 (ATP1A1 Human)
UseCRISPR and TALEN; Co-selection via hdr using ouab…TagsExpressionMammalianMutationQ118R, N129DPromoterAvailabilityAcademic Institutions and Nonprofits only -
pTE4566
Plasmid#88904PurposeExpresses MbCpf1 crRNA and inactive/dead, humanized MbCpf1 nucleaseDepositorInsertsMb crRNA
hMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG
Plasmid#155305PurposeLentiviral vector encoding Rfx Cas13d fused with 2xNLS, 3xFLAG, and 2A-tagged mCherry.DepositorInsertmCherry 2A-tagged to Ruminococcus flavefaciens XPD3002 Cas13d
UseLentiviralTags2xNLS-3xFLAGExpressionMammalianMutationPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
UseTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSExpressionMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSExpressionMutationPromoterPgpdA and PtrpCAvailabilityAcademic Institutions and Nonprofits only -
SPACE (pRZ1813)
Plasmid#140242PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE
UseTagsExpressionMammalianMutationV82G in TadA*, D10A in Cas9, R187W in pmCDA1PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
SPACE-NG (pRZ5150)
Plasmid#140244PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_NG
UseTagsExpressionMammalianMutationV82G in TadA*, NG mutations in SpCas9, D10A in Sp…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
SPACE-VRQR (pRZ5137)
Plasmid#140245PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_VRQR-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_VRQR
UseTagsExpressionMammalianMutationV82G in TadA*, VRQR mutations in SpCas9, D10A in …PromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 10821 - 10840 of 20580 results