-
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorInsertTFAP2C (TFAP2C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L5L2
Plasmid#113738PurposeGateway entry vector containing attL5 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorInsertgRNA RNF138 (RNF138 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-R4R3
Plasmid#113739PurposeGateway entry vector containing attR4 and attR3 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L3L2
Plasmid#113740PurposeGateway entry vector containing attL3 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L5L4
Plasmid#113741PurposeGateway entry vector containing attL5 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L4
Plasmid#113736PurposeGateway entry vector containing attL1 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1R5
Plasmid#113737PurposeGateway entry vector containing attL1 and attR5 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorTagsExpressionMutationPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec6
Plasmid#31118DepositorInsertSec6 shRNA (EXOC3 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup88-HindIII
Plasmid#87329PurposeTo express shRNA against human Nup88DepositorInsertshRNA against human Nup88
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH118-17
Plasmid#91727PurposeNAT-marked C. albicans URA3-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.DepositorInsertNAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2
UseTagsExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianMutationPromoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-NegCon
Plasmid#183554PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio negative control (Luciferase), Fig S2)DepositorInsertLuciferase shRNA
UseTagsExpressionMammalianMutationPromoterCBhAvailable sinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_10bp 5'SS_No BP or pBP_pUC18
Plasmid#100989PurposeRp51a with a tGGTAtGTta->AGGTAAGTAT 5'SS mutant with potential to form 10bps with the U1 snRNA. Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
UseTagsExpressionBacterial and YeastMutationtGGTAtGTta->AGGTAAGTAT 5'SS mutant, TACTA…PromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_SUS1 5'ss_No_BP_pBP-pUC18
Plasmid#100990PurposeContains model Rp51a with a GGTAtGT->tGTAtGa 5'SS mutant (SUS1 5'SS sequence). Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
UseTagsExpressionBacterial and YeastMutationGGTAtGT->tGTAtGa 5'SS mutant, TACTAAC->…PromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #9
Plasmid#174166Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only