-
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorTagsExpressionMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorInsertets2 (ets2 Zebrafish)
UseGateway entry vectorTagsExpressionMutationN189D (rs502796915); S231NPromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
R777-E300 Hs.RPS6KB2-nostop
Plasmid#70584PurposeGateway ORF clone of human RPS6KB2 [NM_003952.2] without stop codon (for C-terminal fusions)DepositorInsertRPS6KB2 (RPS6KB2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E082 Hs.EXOC8-nostop
Plasmid#70366PurposeGateway ORF clone of human EXOC8 [NM_175876.4] without stop codon (for C-terminal fusions)DepositorInsertEXOC8 (EXOC8 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E058 Hs.EIF4EBP2-nostop
Plasmid#70342PurposeGateway ORF clone of human EIF4EBP2 [NM_004096.4] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP2 (EIF4EBP2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E060 Hs.EIF4EBP3-nostop
Plasmid#70344PurposeGateway ORF clone of human EIF4EBP3 [NM_003732.2] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP3 (EIF4EBP3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E066 Hs.ETS2-nostop
Plasmid#70350PurposeGateway ORF clone of human ETS2 [NM_005239.5] without stop codon (for C-terminal fusions)DepositorInsertETS2 (ETS2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human-Dysferlin-Original
Plasmid#60216PurposeHuman dysferlin (accession #NM_003494) cDNA in pDONR221 plasmid which can be used as an entry vector for Invitrogen’s gateway system.DepositorInsertDysferlin (DYSF Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
R777-E013 Hs.ARHGEF2
Plasmid#70297PurposeGateway ORF clone of human ARHGEF2 [NM_001162383.1] with stop codon (for native or N-terminal fusions)DepositorInsertARHGEF2 (ARHGEF2 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E127 Hs.MAPK3
Plasmid#70411PurposeGateway ORF clone of human MAPK3 [NM_002746.2] with stop codon (for native or N-terminal fusions)DepositorInsertMAPK3 (MAPK3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-GFP-V5_IDG-K
Plasmid#135242PurposeGateway destination clone of GFP (as control) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertGFP-V5
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianMutationPromoterUbiquitinAvailable sinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E053 Hs.EGFR
Plasmid#70337PurposeGateway ORF clone of human EGFR [NM_005228.3] with stop codon (for native or N-terminal fusions)DepositorInsertEGFR (EGFR Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E015 Hs.BRAF
Plasmid#70299PurposeGateway ORF clone of human BRAF [NM_004333.4] with stop codon (for native or N-terminal fusions)DepositorInsertBRAF (BRAF Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E114 Hs.JUN-nostop
Plasmid#70398PurposeGateway ORF clone of human JUN [NM_002228.3] without stop codon (for C-terminal fusions)DepositorInsertJUN (JUN Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E091 Hs.FLT3
Plasmid#70375PurposeGateway ORF clone of human FLT3 [NM_004119.2] with stop codon (for native or N-terminal fusions)DepositorInsertFLT3 (FLT3 Human)
UseGateway entry cloneTagsExpressionMutationT227M (human SNP)PromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSL
Plasmid#158444PurposeGateway Cloning compatible entry vector for the human CTSL gene.DepositorInsertCTSL (CTSL Human)
UseGateway entry vectorTagsExpressionMutationPromoterAvailable sinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E113 Hs.JUN
Plasmid#70397PurposeGateway ORF clone of human JUN [NM_002228.3] with stop codon (for native or N-terminal fusions)DepositorInsertJUN (JUN Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E063 Hs.ETS1
Plasmid#70347PurposeGateway ORF clone of human ETS1 [NM_005238.3] with stop codon (for native or N-terminal fusions)DepositorInsertETS1 (ETS1 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-Flag-GFP_IDG-K
Plasmid#135275PurposeGateway destination clone of GFP (as control) tagged with N-terminal Flag for generating protein-protein networks using fusion tag affinity-based proteomicsDepositorInsertFlag-GFP
UseLentiviral; Gateway destinationTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
LO601: pMVP (R4-R3) destabilized firefly luciferase (Luc2P)
Plasmid#132926PurposepMVP R4-R3 entry plasmid, contains destabilized Firefly Luciferase (Luc2P) for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertLuc2P
UseLuciferase and Synthetic Biology; Pmvp gateway en…TagsPEST destabilization domainExpressionMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only