Showing: 9041 - 9060 of 16102 results
-
Plasmid#58896PurposeExpresses GFP tagged full length TEM4 protein with amino acids 125 - 135 deletedDepositorInsertTEM4 (ARHGEF17 Human)
UseTagsEGFPExpressionMammalianMutationDeleted aa's 125-135PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pmCherry-NES-OptoJNKi
Plasmid#89739PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to cytoplasm, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pmCherry-3xNLS-OptoJNKi
Plasmid#89740PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to nucleus, wild-type photosensor, inhibitor JIP11DepositorInsertNLS-OptoJNKi
UseFluorescent proteinTagsmCherryExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pDEST-EGFP-Cx43ML-N1
Plasmid#49860PurposeEncodes human connexin 43 with all internal methionines mutated to leucine and a C_terminal EGFP fusion tagDepositorInsertConnexin 43 (GJA1 Human)
UseTagsEGFPExpressionMammalianMutationAll internal Methionines mutated to Leucine. No s…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
mCh-BICD2*-strep
Plasmid#120168PurposeExpresses a chimera of mCherry (fluorescent tag), a BICD2-based adaptor and streptavidinDepositorInsertBICD cargo adaptor 2 (Bicd2 Mouse)
UseTagsStreptavidin and mCherryExpressionMammalianMutationTruncated BICD2: 15-595 aaPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-TetR
Plasmid#103798PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hTRF1
Plasmid#103802PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hPMLIII
Plasmid#103808PurposeBLInCR 'Localizer' construct that marks the PML nuclear bodies and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pmCherry-Zdk1-EB1C
Plasmid#107695PurposeC-terminal half of π-EB1, mCherry-tagged, dissociates from microtubule ends in blue lightDepositorInsertMAPRE1 (MAPRE1 Human)
UseTagsZdk1 and mCherryExpressionMammalianMutationEB1 aa 186-268PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Zdk1-EB1C
Plasmid#107696PurposeC-terminal half of π-EB1, EGFP-tagged, dissociates from microtubule ends in blue lightDepositorInsertMAPRE1 (MAPRE1 Human)
UseTagsEGFP and Zdk1ExpressionMammalianMutationEB1 aa 186-268PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-MIOX
Plasmid#166680PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1 and GAL10AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)
Plasmid#166853PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationF641G, I645GPromoterpCuAvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)
Plasmid#166854PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationF641E, I645EPromoterpCuAvailabilityAcademic Institutions and Nonprofits only -
EGFP-GRAM1b
Plasmid#211494PurposeExpression of EGFP-tagged GRAM domain of GRAMD1b (EGFP-GRAM1b) in mammalian cellsDepositorInsertGRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
EGFP-GRAM-H
Plasmid#211700PurposeExpression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187L mutation (EGFP-GRAM1b G187L) in mammalian cellsDepositorInsertGRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseTagsEGFPExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pSBinit
Plasmid#110100PurposeE.coli entry and expression vector for FX cloning system, N-terminal pelB signal sequence and C-terminal myc and 6xHisTagDepositorTypeEmpty backboneUseTagsmyc, HisExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/EGFP/pdCas9-C1
Plasmid#162759PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
UseTagsExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 9041 - 9060 of 16102 results