Showing: 9041 - 9060 of 20575 results
-
Plasmid#180268PurposeLentiviral expression vector for CRISPRa-SAM with GARP targeting sgRNADepositorInsertGARP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgBB: pHR-hU6-CasMINI sgRNA_#2; EF1a-Puro-T2A-BFP- WPRE
Plasmid#180280PurposeThe CasMINI sgRNA cloning backbone with sites 'BsmBI' for inserting new guide sequences.DepositorInsertCasMINI sgRNA (backbone) and BFP
UseLentiviralTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…AvailabilityAcademic Institutions and Nonprofits only -
pYPQ220-Ultra
Plasmid#176889PurposeGateway entry plasmid (attL1 & attR5) expressing AsCas12a with M537R and F870L mutations, without promoterDepositorInsertAsCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNucleoplasmin NLS and SV40 NLSExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-E795L
Plasmid#176890PurposeGateway entry plasmid (attL1 & attR5) expressing LbCas12a with E795L mutation, without promoterDepositorInsertLbCas12a-E795L
UseCRISPR; Gateway compatible lbcpf1 entry cloneTagsNucleoplasmin NLS and SV40 NLSExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
UseTagsExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailabilityAcademic Institutions and Nonprofits only -
pM124: pAAV-EFS-CasRx-VEGFA presgRNA
Plasmid#166872PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA for RNA-editingDepositorInsertsU6-VEGFA presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6AvailabilityAcademic Institutions and Nonprofits only -
pM125: pAAV-EFS-CasRx-VEGFA array presgRNA
Plasmid#166873PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA array for RNA-editingDepositorInsertsU6-VEGFA array presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B1
Plasmid#172842PurposeCRISPIE donor B1 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B2
Plasmid#172843PurposeCRISPIE donor B2 (Zhong et al, eLife 2021), mRuby3 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mRuby3
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 9041 - 9060 of 20575 results