-
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…PromoterAvailable sinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
-
pENTR/pTER shMDC1 (441-1)
Plasmid#22192DepositorInsertsh Mediator of DNA damage checkpoint 1
UseRNAi; Entry vectorTagsExpressionMutationPromoterAvailable sinceDec. 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
BPK764
Plasmid#65767PurposeBacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialMutationPromoterT7 (x2)Available sinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorInsertsgRNA Targeting C-terminus of VIM (VIM Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458 eSp(1.1) V3
Plasmid#226963PurposeCBh-eSpCas9(1.1)-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-BSD
Plasmid#216123PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the blasticidin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-KRAB-GFP backbone
Plasmid#194281PurposeVector for CRISPRi-GFP expression ready for gateway cloning of sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterEF1aAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-CLTC
Plasmid#227312PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of CLTC for knock-in.DepositorInsertsgRNA Targeting C-terminus of CLTC (CLTC Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI #2
Plasmid#139666PurposeEndogenous tagging of β-actin: N-terminal (amino acid position: before startcodon)DepositorInsertgRNA and GFP donor
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Bsn-GFP KI
Plasmid#139665PurposeEndogenous tagging of Bassoon: C-terminal (amino acid position: F3938)DepositorInsertgRNA and GFP donor
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRTagsExpressionMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE unc13a GFP KI
Plasmid#131498PurposeEndogenous tagging of Munc13-1: C-terminal (amino acid position: A1762)DepositorInsertgRNA and GFP donor (Unc13a Rat)
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only