Showing: 8181 - 8200 of 20568 results
-
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoterAvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B S. aureus, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoter;AvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA1
Plasmid#92312PurposeCRISPR-GFP-gRNA for cutting WT1DepositorInsertWT1 (WT1 Human)
UseTagsCRISPR GFPExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA2
Plasmid#92313PurposeCRISPR-GFP-gRNA for cutting WT1DepositorInsertWT1 (WT1 Human)
UseTagsCRISPR GFPExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
AAV-nEF-dCas9
Plasmid#106430PurposeExpresses SpdCas9 from the nEF promoter in AAV backboneDepositorInsertnEF-dCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianMutationPromoternEFAvailabilityAcademic Institutions and Nonprofits only -
AAV-CMVc-Cas9
Plasmid#106431PurposeExpresses SpCas9 from the CMVc promoter in AAV backboneDepositorInsertCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianMutationPromoterCMVcAvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorInsertgRNA targeting Hgs (Hgs Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235)
Plasmid#160646PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.VSVg_NGFR
Plasmid#158232PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.NWS_NGFR
Plasmid#158234PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.NWSExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.V5_NGFR
Plasmid#158235PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.FLAG_NGFR
Plasmid#158236PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.V5_NGFR
Plasmid#158237PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.FLAG_NGFR
Plasmid#158238PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.VSVg_NGFR
Plasmid#158239PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailabilityAcademic Institutions and Nonprofits only
Showing: 8181 - 8200 of 20568 results