-
Plasmid#98096PurposeaA-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha A-crystallin promoter 1 kb fragment, Danio rerio (cryaa Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio alpha A-crystallin 1 kb fragment (-1028/-1)Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mScarletI-NLS. PGK-puro
Plasmid#136263PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmScarletI-NLSExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM237 - pEXP[Prpl-3 | histamine | rpl-3 UTR]
Plasmid#159796PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Prpl-3 | histamine | rpl-3 UTR]
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_OAS3
Plasmid#99324PurposeLuciferase validation vector with OAS3 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr12: 94575894 -94578286
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_ISG15
Plasmid#99322PurposeLuciferase validation vector with ISG15 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr1: 947976 -949995 (ISG15 Human)
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_Stat3(A662C,N664C,V667L)-P2A-Hygro_Barcode
Plasmid#170254PurposeBarcoded lentiviral vector to express Stat3 (A662C, N664C, V667L) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorInsertSTAT3 (STAT3 Human)
UseLentiviralTagsExpressionMutationA662C, N664C, V667LPromoterEF1aAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFI27
Plasmid#99320PurposeLuciferase validation vector with IFI27 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr14: 94575894-94578286
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSEM236 - pEXP[Pmlc-2 | histamine | rpl-3 UTR]
Plasmid#159797PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Pmlc-2 | histamine | rpl-3 UTR]
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pALPS_3'LTR GFP@gag start SFFV-
Plasmid#101337PurposeRepaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.DepositorInsertGFP
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-STAT5A-DNL-CMV-GFP
Plasmid#83253PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFPDepositorInsertsUseAdenoviralTagsExpressionMutationC-terminal deletion of 351 nucleotides (dominant …PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2kb, distal)
Plasmid#14981DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseTagsExpressionMutationincludes distal fragment of human frataxin promot…PromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha Bb-crystallin 1kb promoter/AcGFP
Plasmid#98098PurposeaBb-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha Bb-crystallin promoter 1 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio aBb-crystallin 1 kb fragment (-1074/-1)Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 omega1 Tnos:BASTA:Pnos - P35S:hCas9:Tnos (GB3469)
Plasmid#160647Purposemodule containing the human codon optimized Cas9 and the BASTA selection markerDepositorInsertBASTA / Cas9
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnos, P35SAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha Ba-crystallin 3kb promoter/AcGFP
Plasmid#98097PurposeaBA-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha Ba-crystallin promoter 3 kb fragment, Danio rerio (cryaba Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio alpha Ba-crystallin 3 kb fragment (-3000/-1)Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant ss-SigmaR1DTM-mNeonGreen R119A F191A
Plasmid#226576PurposeEncodes mutant siRNA resistant SigmaR1 protein (transmembrane region deletion + substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
UseTagsmNeonGreenExpressionMammalianMutationR119A, F191APromoterAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRIP8b (constant) ion channel scFv [N212/17]
Plasmid#206725PurposeMammalian Expression of TRIP8b (constant) ion channel scFV. Derived from hybridoma N212/17 scFv.DepositorInsertTRIP8b (constant) ion channel (Rattus norvegicus) recombinant scFV (Pex5l Mouse)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO–γ-tubulinWT-RNAi-resistant-GFP
Plasmid#205603PurposeTet-inducible expression of WT gamma-tubulin in human cells, harbors silent mutations in shRNA target site, FLP-In mediated insertionDepositorInsertγ-tubulinWT-RNAi-resistant-GFP
UseTagsGFPExpressionMammalianMutationG2228A, C2231T, C2237T, G2240APromoterAvailable sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO–γ-tubulinΔGTP-RNAi-resistant-GFP
Plasmid#205604PurposeTet-inducible expression of N229A gamma-tubulin in human cells, harbors silent mutations in shRNA target site, FLP-In mediated insertionDepositorInsertγ-tubulinΔGTP-RNAi-resistant-GFP
UseTagsGFPExpressionMammalianMutationG2228A, C2231T, C2237T, G2240A, N229APromoterAvailable sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only