Showing: 8161 - 8180 of 20568 results
-
Plasmid#76421Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK1DepositorInsertIRAK1 (IRAK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Crimson
Plasmid#70683PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and Crimson reporter from EF-1a promoter. Lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Crimson Reporter
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEf1-a and hU6AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
B52 + FANCM sgSTOP
Plasmid#100710PurposeB52 plasmid expressing FANCM sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting FANCM (cloned using BbsI) (FANCM Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailabilityAcademic Institutions and Nonprofits only -
B52 + CHEK2 sgSTOP
Plasmid#100712PurposeB52 plasmid expressing CHEK2 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting CHEK2 (cloned using BbsI) (CHEK2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoterAvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B S. aureus, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianMutationPromoterU6 promoter;AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterhSynAvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
AAV-nEF-dCas9
Plasmid#106430PurposeExpresses SpdCas9 from the nEF promoter in AAV backboneDepositorInsertnEF-dCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianMutationPromoternEFAvailabilityAcademic Institutions and Nonprofits only -
AAV-CMVc-Cas9
Plasmid#106431PurposeExpresses SpCas9 from the CMVc promoter in AAV backboneDepositorInsertCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianMutationPromoterCMVcAvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorInsertgRNA targeting Hgs (Hgs Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-VP64-BFP
Plasmid#46912PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFPDepositorInsertsdCas9-VP64-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags3xNLS, BFP, and VP64 domainExpressionMammalianMutationPromoterLTR and PGKAvailabilityAcademic Institutions and Nonprofits only -
pMSCV-LTR-dCas9-p65AD-BFP
Plasmid#46913PurposeHuman expression vector containing MSCV LTR promoter, dCas9 that is fused to 2x NLS, p65 activation domain and tagBFPDepositorInsertsdCas9-p65AD-BFP fusion
Puromycin resistance
UseCRISPR and RetroviralTags2xNLS, BFP, and VP64 domainExpressionMammalianMutationPromoterLTR and PGKAvailabilityAcademic Institutions and Nonprofits only -
pU6-sgCD71-2
Plasmid#46918PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CD71 geneDepositorInsertsUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLkb1/Cre
Plasmid#66894PurposeExpresses an Lkb1-targeting gRNA and Cre-recombinaseDepositorInsertsgLkb1
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only
Showing: 8161 - 8180 of 20568 results