Showing: 6861 - 6880 of 20564 results
-
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorInsertpCFD3-ovoD1 (ovo Fly)
UseCRISPRTagsExpressionInsectMutationPromoterU6:3AvailabilityAcademic Institutions and Nonprofits only -
1375_pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-CB-SACas9-HA-OLLAS-spA
Plasmid#109311PurposePlasmid for AAV SaCas9 Mammalian Expression with a gRNA against LdlrDepositorInsertLdlr gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
1531_pAAV-U6-SA-Self1-gRNA-HLP-EmGFP-spA
Plasmid#109318PurposePlasmid for liver-specific expression of EmGFP with a gRNA against SaCas9DepositorInsertSaCas9 RuvC gRNA
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
TBG-Vector
Plasmid#109396PurposeAAV-CRISPR knockout plasmid with Cre recombinase driven by TBG promoter for direct in vivo genome editing in mouse liverDepositorTypeEmpty backboneUseAAV, CRISPR, Mouse Targeting, and Synthetic Biolo…TagsExpressionMammalianMutationPromoterTBGAvailabilityAcademic Institutions and Nonprofits only -
dCas9-hHDAC3
Plasmid#98591Purpose3rd generation lenti vector encoding dCas9-hHDAC3 (EF1a-NLS-dCas9(N863)-hHDAC3). Expresses dCas9 fused to human HDAC3.DepositorInsertdCAS9-HDAC3 (HDAC3 Human, Synthetic, S. pyogenes)
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pYPQ233 (dLbCpf1-SRDX)
Plasmid#86211PurposeDeactivated LbCpf1-SRDX repressor fusion; transcriptional repressor dCpf1 Gateway entry plasmidDepositorInsertLbCpf1
UseCRISPRTags5' and 3' NLS and SRDX repressorExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pY036_ATP1A1_G3
Plasmid#86617PurposeExpresses the ATP1A1 G3 crRNA in combination with AsCpf1-3xHA to target ATP1A1 exon 4. U6-crRNA(ATP1A1 G3)-CBh-AsCpf1DepositorInsertATP1A1 G3 crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via nhej using ouabainTags3xHAExpressionMammalianMutationPromoterCBhAvailabilityAcademic Institutions and Nonprofits only -
pY036_ATP1A1_G5
Plasmid#86618PurposeExpresses the ATP1A1 G5 crRNA in combination with AsCpf1-3xHA to target ATP1A1 intron 4. U6-crRNA(ATP1A1 G5)-CBh-AsCpf1DepositorInsertATP1A1 G5 crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via hdr using ouabainTags3xHAExpressionMammalianMutationPromoterCBhAvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
Showing: 6861 - 6880 of 20564 results