We narrowed to 9,955 results for: CAG
-
Plasmid#240293PurposeKI:Gria1 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#2
Plasmid#240308PurposeDonor:smFP-V5 KO:Gphn#2DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS-mak10 gRNA
Plasmid#160385PurposeExpresses guide RNA for targeting MAK10 in yeastDepositorInsertmak10 gRNA
ExpressionYeastPromoterRNA pol III promoter (tRNA-Tyr)Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int3
Plasmid#188683Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgNT-hU6-sgLkb1_1st
Plasmid#177221PurposeExpresses a Lkb1-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgNT1/sgLkb1_1st
UseLentiviralPromotermU6/hU6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgNT-hU6-sgLkb1_2nd
Plasmid#177223PurposeExpresses a Lkb1-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgNT1/sgLkb1_2nd
UseLentiviralPromotermU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgLkb1_2nd-hU6-sgNT
Plasmid#177222PurposeExpresses a Lkb1-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgLkb1_2nd/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_2nd-hU6-sgSik3_1st
Plasmid#177218PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik1_2nd/sgSik3_1st
UseLentiviralPromotermU6/hU6Available SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik3_1st-hU6-sgNT
Plasmid#177214PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik3_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_1st-hU6-sgNT
Plasmid#177212PurposeExpresses a Sik1-targeting (mU6) and non-targeting (hU6) gRNAs, and Cre-recombinaseDepositorInsertsgSik1_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac4
Plasmid#126884PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Rac4
Plasmid#126896PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ OBfold
Plasmid#126901PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ OBfold
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLexm
Plasmid#99844Purposemammalian expressionDepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only