We narrowed to 14,326 results for: CAG
-
Plasmid#221659PurposeRubicon tagged N-terminally with EGFP; clone a gift from the Hurley Lab at UC BerkeleyDepositorAvailable sinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pSLQ10625
Plasmid#239268PurposeExpresses NES-dCas13b-ABI for CRISPR-TO perturbation in primary mouse cortical neuronsDepositorInsertNES-dPspCas13b-EGFP-ABI
TagsFlag tag and V5 tagExpressionMammalianMutationH133A and H1058A in PspCas13bPromoterCAGAvailable sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CALNL-RARa-VP16
Plasmid#185560PurposeCre Dependent ubiquitous expression of constitutively active Retinoic Acid Receptor alphaDepositorAvailable sinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFL-mPML-3KRmut-iB
Plasmid#140287PurposeExpression of mouse PML KR mutantDepositorAvailable sinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
mouse a5 full length
Plasmid#217810PurposeFull length mouse integrin a5 expressionDepositorAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b8 full length
Plasmid#217817PurposeFull length mouse integrin b8 expressionDepositorAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b6 full length
Plasmid#217816PurposeFull length mouse integrin b6 expressionDepositorAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b5 full length
Plasmid#217815PurposeFull length mouse integrin b5 expressionDepositorAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRY2clust-mCherry-RANK
Plasmid#208612PurposeMammalian expression of CRY2clust-mCherry-RANK (Opto-RANKc)DepositorInsertCRY2clust-mCherry-RANK (Cry2 Mouse, Mustard Weed)
TagsmCherryExpressionMammalianPromoterCAGAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna1
Plasmid#127648PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
ExpressionMammalianAvailable sinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pLKO-shSmad2
Plasmid#37051DepositorAvailable sinceJan. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available sinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Arpc5 KI
Plasmid#131503PurposeEndogenous tagging of Arp2/3 complex subunit 5: C-terminal (amino acid position: STOP codon)DepositorAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
ExpressionMammalianAvailable sinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pLKO-shSmad2
Plasmid#37051DepositorAvailable sinceJan. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available sinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorAvailable sinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
Antibody#194521-rAbPurposeAnti-c-Myc chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a goat IgG3 Fc.DepositorRecommended applicationsWestern BlotReactivityHumanIsotypeIgG3Trial sizeAvailable to purchaseAvailable sinceFeb. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits