-
Plasmid#139425PurposeRecyclable marker for use in Cryptococcus neoformans. Contains the amdS2 counterselectable marker flanked by the mRuby3 ORF and a flexible linker at the 5' end.DepositorInsertmRuby3
UseTagsExpressionYeastMutationPromoterTEF1Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-EKAR
Plasmid#181858PurposeGenetically encoded FRET-based sensor for monitoring ERK activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-EKAR
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH666
Plasmid#169610PurposeTier-2 vector encoding PTtgO2-driven SEAP-p2A-iRFP670, PmPGK1-driven TtgA and PmPGK1-driven mRuby2 expression (PTtgO2-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-TtgA-pA::PmPGK1-mRuby2-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven TtgA expression cassette and PPGK-driven YPet expression cassette
UseTagsExpressionMammalianMutationPromotertetO7-PCMVmin / PPGK / PPGKAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-CfANLN_sgRNA
Plasmid#183879PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorInsertH2BC11 sgRNA spacer (H2BC11 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-MYH10_sgRNA
Plasmid#183886PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorInsertMYH10 sgRNA spacer (MYH10 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-AKAR
Plasmid#181844PurposeGenetically encoded FRET-based sensor for monitoring PKA activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-AKAR
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-TUBA1B_sgRNA
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorInsertTUBA1B sgRNA spacer (TUBA1B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorInsertRHOA sgRNA spacer (RHOA Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ECT2_sgRNA
Plasmid#183875PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorInsertECT2 sgRNA spacer (ECT2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianMutationPromoterEF1aAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-ICUE
Plasmid#181845PurposeGenetically encoded FRET-based sensor for monitoring cAMP dynamics near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-ICUE (RAPGEF3 Human)
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSET-RCaMP1h
Plasmid#42874Purposea single-wavelength red-shifted genetically encoded calcium indicator constructed from calmodulin and cp-mRubyDepositorInsertRed Fluorescent Calcium binding Protein
UseTagsEK (Enterokinase) Recognition Site, His Tag (6x),…ExpressionBacterialMutationPromoterT7Available sinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
UseTagsExpressionYeastMutationPex22(1-36)PromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only