-
Plasmid#166725Purposenon targeting sgRNADepositorInsertNon-targeting guide
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorInsertXYLT2 sgRNA (XYLT2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSNRK
Plasmid#138694PurposeExpresses a human SNRK-targeting sgRNA and Cas9DepositorInsertsgSNRK human (SNRK Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human GeCKO Lentiviral sgRNA Library v2 (lentiGuide-Puro)
Pooled Library#1000000049PurposeCRISPR gRNA knockout pooled library for targeting the human genomeDepositorAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, genome-wide, top 5 sgRNAs/gene
Pooled Library#83978PurposeVersion 2 of the human CRISPRa genome wide libraryDepositorUseLentiviralAvailable sinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, genome-wide, top 5 sgRNAs/gene
Pooled Library#83969PurposeVersion 2 of the human CRISPRi genome wide libraryDepositorUseLentiviralAvailable sinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, genome-wide, top 5 sgRNAs/gene
Pooled Library#83987PurposeVersion 2 of the mouse CRISPRi genome wide libraryDepositorUseLentiviralAvailable sinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, genome-wide, top 5 sgRNAs/gene
Pooled Library#83996PurposeVersion 2 of the mouse CRISPRa genome wide libraryDepositorUseLentiviralAvailable sinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Unassigned (m7), top 5 sgRNAs/gene
Pooled Library#83995PurposeMouse CRISPRi Pooled Library targeting unassigned genesDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Unassigned (h7), top 5 sgRNAs/gene
Pooled Library#83986PurposeHuman CRISPRa Pooled Library targeting unassigned genesDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Unassigned (m7), top 5 sgRNAs/gene
Pooled Library#84004PurposeMouse CRISPRa Pooled Library targeting unassigned genesDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Unassigned (h7), top 5 sgRNAs/gene
Pooled Library#83977PurposeHuman CRISPRi Pooled Library targeting unassigned genesDepositorAvailable sinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti MS2-P65-HSF1_Hygro
Plasmid#61426Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2DepositorInsertMS2-P65-HSF1_2A_Hygro (HSF1 Human, Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationN55K in MS2PromoterEF1AAvailable sinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOT_1 - lenti-EFS-LTBR-2A-puro
Plasmid#181970PurposeExpresses human LTBR linked to puromycin resistance via P2A for lentiviral delivery.DepositorInsertLTBR (LTBR Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOT_2 - lenti-EFS-tNGFR-2A-puro
Plasmid#181971PurposeExpresses human truncated NGFR linked to puromycin resistance via P2A for lentiviral delivery.DepositorInserttNGFR (NGFR Human)
UseLentiviralTagsExpressionMutationtruncation: aa 11-276PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgAMPKa1
Plasmid#138704PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorInsertsgAMPKa1 human (PRKAA1 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa1
Plasmid#138684PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorInsertsgAMPKa1 human (PRKAA1 Human)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only