We narrowed to 607 results for: Anti-CRISPR
-
Plasmid#194003PurposepBac-U6-crCHIKV-array-UTR-3xp3-tdTomatoDepositorInsert4 gRNAs targeting CHIKV
ExpressionInsectAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1085F
Plasmid#191375PurposepBac-U6-crYellow-array-UTR-3xp3-tdTomatoDepositorInsert4 gRNAs targeting yellow
ExpressionInsectAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1085L
Plasmid#191376PurposepBac-U6-crGFP-array-UTR-opie2-eGFP-3xp3-tdTomatoDepositorInsert4 gRNAs targeting GFP
ExpressionInsectAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g1
Plasmid#170824PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g2
Plasmid#170829PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDS_Cas9-NLS
Plasmid#136121PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPRDepositorInsertCDS_AtcoCas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
INT_GFPsp
Plasmid#212144PurposePreparatory plasmid for operon integration into the genome using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC, green fluorescent protein
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_GFPsp_CamRcargo
Plasmid#212143PurposePreparatory plasmid for gene disruption into the genome using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC, green fluorescent protein
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDS12_Cas9-NLS
Plasmid#136122PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPR. CDS12 for N-term fusion with a CTAGDepositorInsertCDS12_AtcoCas9-NLS(noStop)
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
INT_SS9sp
Plasmid#212145PurposeEffector plasmid for for operon integration into the genome (Safe Site 9) using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2_NOP1gRNA-Cas9-CsA
Plasmid#136139PurposePlasmid with NOP1-gRNA to tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35Sx2:HygR p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2_2xNOP1gRNA-Cas9-CsA
Plasmid#136140PurposePlasmid with 2 different NOP1-gRNA. Targets 500 bp apart in the genome. To tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35S:HygR p5-MpU6:NOP1gRNA2 p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 PPP2CA g1
Plasmid#170822PurposePiggyBac Cas13d sgRNA plasmid for PPP2CA knockdownDepositorInsertCas13d PPP2CA gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGTag NGFR EGFP nLAP -2
Plasmid#194507PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertNGFR-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only