-
Plasmid#89644PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2a (Cdkn2a Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1/Cre
Plasmid#89645PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Keap1 (Keap1 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterA. thaliana egg cell promoterAvailable sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSMART Tmem192-3X HA (targeting vector for genomic tagging)
Plasmid#175777PurposepSMART Tmem192-3X HA (targeting vector for genomic tagging)DepositorInsertTMEM192 (TMEM192 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgApc/Cre
Plasmid#89641PurposeExpresses an Apc-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Apc (Apc Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
UseTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRb1/Cre
Plasmid#89647PurposeExpresses an Rb1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rb1 (Rb1 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1a/Cre
Plasmid#89642PurposeExpresses an Arid1a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1a (Arid1a Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NS3-NLS/VPR
Plasmid#112244PurposeEncodes the drug-preservable Cas9-NS3-NLS/VPR, which can be used to activate gene expression when combined with an NS3 inhibitor and appropriately designed sgRNA.DepositorInsertdCas9-NS3-NLS/VPR
UseTagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atm (Atm Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianMutationPromoterSynapsinAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBP-HRV3C-AcrIF9
Plasmid#141442PurposeExpression of AcrIF9 in E. coli, tagged with an HRV3C-cleavage fusion to Maltose Binding Protein.DepositorInsertAcrIF9
UseTagsHRV3C cleavage site and Maltose Binding ProteinExpressionBacterialMutationPromoterptacAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgp53/Cre
Plasmid#89646PurposeExpresses a p53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting p53 (Trp53 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only