-
Plasmid#89647PurposeExpresses an Rb1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rb1 (Rb1 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1a/Cre
Plasmid#89642PurposeExpresses an Arid1a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1a (Arid1a Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NS3-NLS/VPR
Plasmid#112244PurposeEncodes the drug-preservable Cas9-NS3-NLS/VPR, which can be used to activate gene expression when combined with an NS3 inhibitor and appropriately designed sgRNA.DepositorInsertdCas9-NS3-NLS/VPR
UseTagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgApc/Cre
Plasmid#89641PurposeExpresses an Apc-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Apc (Apc Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atm (Atm Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
UseTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBP-HRV3C-AcrIF9
Plasmid#141442PurposeExpression of AcrIF9 in E. coli, tagged with an HRV3C-cleavage fusion to Maltose Binding Protein.DepositorInsertAcrIF9
UseTagsHRV3C cleavage site and Maltose Binding ProteinExpressionBacterialMutationPromoterptacAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgp53/Cre
Plasmid#89646PurposeExpresses a p53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting p53 (Trp53 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA14
Plasmid#199586PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG CLTX-CAR
Plasmid#157743Purposeknock CLTX-CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertchlorotoxin containing chimeric antigen receptor targeting glioblastoma
UseCRISPR, Synthetic Biology, and TALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR
Plasmid#157744Purposeknock CLTX-NKG2D-2B4-CD3z CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertchlorotoxin containing chimeric antigen receptor targeting glioblastoma
UseCRISPR, Synthetic Biology, and TALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-VPH
Plasmid#120556PurposeEncode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to 2 tandem ERT2, VP64, P65 and HSF1DepositorInsertscFvGCN4, GB1, ERT2, VP64, P65 and HSF1
UseLentiviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas9
Plasmid#196325Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding SpCas9 in place of viral GPDepositorInsertFull length TSWV M antigenome encoding SpCas9 in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only