-
Plasmid#140375PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 5BP dowsntream from the promoterDepositorInsertT7-5BP-tetO-3WJdB-T
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro-{beta}4 SCR
Plasmid#16267DepositorInsertSCR Beta 4 Integrin (ITGB4 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJBL704
Plasmid#140374PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 4BP dowsntream from the promoterDepositorInsertT7-4BP-tetO-3WJdB-T
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CB1R-V2tail-TevN-BLITz1-TetR-VP16
Plasmid#89872Purposeexpresses CB1R-iTango component in mammalian cellsDepositorInsertCB1R-V2tail-TevN-BLITz1-TetR-VP16
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDSM-bc-Ptdh3-CAD-Ttdh1
Plasmid#127727PurposeYeast pathway position 3. CAD transcription unit with the TDH3 promoter and TDH1 terminator.DepositorInsertcis-aconitate decarboxylase
UseSynthetic BiologyTagsExpressionYeastMutationPromoterPtdh3Available sinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMEH305 HA NLS SpCas9 3x high affinity MS2 loops
Plasmid#168216PurposeMammalian expression SV40 and nucleoplasmin NLS SpCas9 with 3 high affinity MS2 loops and fused to an N-terminal HA tagDepositorInsertSV40 NLS SpCas9
UseLentiviralTagsHA, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationPromoterCMVAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTS585P-myc
Plasmid#107498PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation S585P conferring gain of function phenotypeDepositorInsertSerotonin Transporter (SERT) (SLC6A4 Human)
UseTagsExpressionMammalianMutationS585PPromoterCMVAvailable sinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmin/pAS2-1
Plasmid#97407PurposeDesmin (aa 30 – 103) in DNA-binding domain (BD) vector, used for yeast-two hybridDepositorInsertDesmin (DES Human)
UseTagsExpressionYeastMutationPromoterAvailable sinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNIC28-BSA4-G-S18
Plasmid#127825PurposeProduction of recombinant human ribosomal protein S18DepositorInsertRPS18 (RPS18 Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC
Plasmid#140200PurposeCloning vector for LbCas12a crRNAs ( Step 1 of the 2-step cloning alternative). Full PgpdA sequence is reconstituted when amplifying the expression cassette for cloning in a fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsdLbCas12a crRNA scaffoldExpressionMutationPromoterPgpdAAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-let-7a-1
Plasmid#46670DepositorInserthsa-let-7a-1 (MIRLET7A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFGL1170R
Plasmid#116896PurposehH1:mCherry (nuclear marker)DepositorInsertshH1
mCherry
hH1 downstream region
UseFungal expression (in magnaporthe oryzae)TagsExpressionMutationno start codon, no stop codon and without start c…Promoterpromoter lessAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT-G-L11
Plasmid#127831PurposeProduction of recombinant human ribosomal protein L11DepositorInsertRPL11 (RPL11 Human)
UseTagsHis6 - Thioredoxin - TEVExpressionBacterialMutationPromoterT7Available sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S186D
Plasmid#16239DepositorInsertMDM2 (MDM2 Human)
UseTagsGSTExpressionBacterialMutationSer186 replaced by AspPromoterAvailable sinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
TALEN-CCR5L18-CtermQ3
Plasmid#51440PurposeExpresses TALEN targeting left CCR5A site (L18) with Q3 C-terminal domainDepositorInsertTALEN CCR5 Left (L18) Q3 C-term
UseTALENTags3xFLAG and Fok1 EL variantExpressionMammalianMutationK788Q, R792Q and R801QPromoterCMVAvailable sinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
TALEN-CCR5R18-CtermQ3
Plasmid#51441PurposeExpresses TALEN targeting right CCR5A site (R18) with Q3 C-terminal domainDepositorInsertTALEN CCR5 Right (R18) Q3 C-term
UseTALENTags3xFLAG and Fok1 KK variantExpressionMammalianMutationK788Q, R792Q and R801QPromoterCMVAvailable sinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S166D
Plasmid#16238DepositorInsertMDM2 (MDM2 Human)
UseTagsGSTExpressionBacterialMutationSer166 replaced by AspPromoterAvailable sinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only