We narrowed to 24,892 results for: promoter
-
Plasmid#209970PurposeContains Level 0 Part: autoinducible Promoter (PgadB) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_gadB)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP9
Plasmid#209971PurposeContains Level 0 Part: constitutive Promoter (PldhD) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_ldhD)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP1
Plasmid#209963PurposeContains Level 0 Part: mock / negative control Promoter (P-nc) for the construction of Level 1 plasmidsDepositorInsertPromoter (mock)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP2
Plasmid#209964PurposeContains Level 0 Part: constitutive Promoter (P48) for the construction of Level 1 plasmidsDepositorInsertPromoter (P48)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR_hEMSY
Plasmid#125156PurposeGateway entry cloneDepositorInsertEMSY (EMSY Human)
UseGateway entry vectorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
1456_pDEST_miniTol2_R4-R2_Cryst-eGFP
Plasmid#171795PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a eGFP selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR9/9*
Plasmid#177805PurposeThe pre-miR-9/9* sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-9/9*
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TOPO pTRE
Plasmid#68457PurposeTOPO construct expressing pTRE for generation of GMAP-compatible promoterDepositorInsertTetracycline Response Element Promoter
UseGmapExpressionBacterialPromoterPlacAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Rabin8
Plasmid#24910DepositorInsertRabin8 (RAB3IP Human)
UseGateway entry vectorAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RAB10 Q68L-WPRE-UbC-Emerald
Plasmid#203803PurposeLentiviral vector plasmid expressing human RAB10 mutation Q68L (constitutively active mutant) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_human-4xUAS
Plasmid#125150PurposeVector to measure the activity of CP candidates in response to a tethered (4xUAS) GAL4-DBD-COF by determining the abundance of transcripts originating from each candidate in human cellsDepositorInsert4 x upstream activating sequence (UAS)
UseStap-seq screening vectorAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEM235 - [Pmlc-1 | mcherry | cbr-tbb-2 UTR]
Plasmid#159900PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | mcherry | cbr-tbb-2 UTR
ExpressionWormPromoterPmlc-1Available SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pANTO5
Plasmid#131106PurposeTo generate an integrative plasmid carrying the TetR/Pip-OFF system, but not the integraseDepositorInserttetR gene by pFRA61 (Boldrin et al 2010)
ExpressionBacterialAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO Plk4 KD-mCherry
Plasmid#80270Purposemammalian expression plasmid for kinase dead Plk4DepositorAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TFII-I-p70
Plasmid#22187DepositorInsertTFII-I (GTF2I Human)
TagsGST and HisExpressionMammalianMutationContains only amino acids 1-735 C-terminal residu…Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn spCas9
Plasmid#179725Purposehuman synapsin (hSyn)-driven spCas9 lentiviral vector for CRISPR/HITIDepositorInsertspCas9
UseLentiviralAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
GST-N1IC
Plasmid#47612Purposebacterial expression of GST-myc-Notch1 ICDepositorInsertNotch1 intracellular domain (Notch1 Mouse)
TagsGST and mycExpressionBacterialMutationcontains amino acids 1753-2531PromotertacAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pETM6-C4-mCherry
Plasmid#66530PurposeExpresses mCherry under the control of Mutant T7 Promoter C4DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialMutationCodon Optimized for E. coliPromoterMutant T7 Promoter - C4Available SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRDA_186
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only