-
Plasmid#44357DepositorInsertIRBP1783-CHER
UseLentiviralTagsExpressionMutationPromotermurine interphotoreceptor retinoid-binding protei…Available sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Ms-c-Myc-W136E
Plasmid#26024DepositorInsertc-Myc (Myc Mouse)
UseRetroviralTagsExpressionMammalianMutationW136EPromoterAvailable sinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJH131
Plasmid#48260PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae GAL10/GAL1 bidirectional promoter in yeast.DepositorInsertsURA3 3' fragment
URA3 5' fragment
GAL10/GAL1 bidirectional promoter
UseRoutine cloning vectorTagsExpressionMutation-242 upstream to URA3 ORF +495 and URA3 ORF from …PromoterGAL10/GAL1 bidirectionalAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBR322-bom
Plasmid#155178PurposepBICI_2_strong without bom siteDepositorInsertsSucrose Phosphorylase from Bifidobacterium adolescentis (BAD_RS00415 Bifidobacterium adolescentis)
Cellobiose phosphorylase from Cellulomonas uda
UseSynthetic BiologyTagsHis Tag and Strep - Tag IIExpressionBacterialMutationPromoterAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHES873
Plasmid#87945PurposeExpresses estradiol-inducible synthetic transcription factor in yeast under control of GAL1 promoter. It activates transcription of promoters containing Zif268 binding sites.DepositorInsertpGAL1- Zif268 DBD - hPR LBD - MSN2 AD (PGR Human, Budding Yeast)
UseTagsExpressionYeastMutationPromoterGAL1Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF6 rglut1 HA complete
Plasmid#89572Purposerglut1 HA completeDepositorInsertpEF6 rglut1 HA complete (Slc2a1 Rat)
UseTagsV5-His A, B, C and rglut1 HA completeExpressionMammalianMutationPromoterEF-1αAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBP-Bba_K822000
Plasmid#74094PurposeL-Lactate inducible promoter from E. coli MG1655DepositorInsertBba_K822000 (L-Lactate promoter - E. coli MG1655)
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterNAAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-rev-erbα
Plasmid#186823PurposeFluorescent reporter for rev-erbα expressionDepositorInsertrev-erbα promoter
UseLuciferaseTagsExpressionMutationPromoterrev-erbα promoterAvailable sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
attB-P7-attP-YFP
Plasmid#195571PurposeA strong P7 promoter flanked by Bxb1 recombination sites attB and attP. Downstream of attP is a strong RBS and YFP coding sequence.DepositorInsertPromoter flanked by Bxb1 recombination sites attB and attP with YFP downstream
UseSynthetic BiologyTagsExpressionMutationPromoterP7Available sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK-flag-GFP 1-10 tetra Cys
Plasmid#78589PurposeExpression flag-GFP 1-10 tetra Cys in mammalian cellsDepositorInsertflag-GFP 1-10 tetra Cys
UseTagsflagExpressionMammalianMutationPromoterCMVAvailable sinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQE9-His-p97deltaD2
Plasmid#17229DepositorInsertp97 (Vcp Mouse)
UseTagsHisExpressionBacterialMutationchanged codon 457 to stop codonPromoterAvailable sinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
secCitrine
Plasmid#181964PurposeBasic chitinase signal peptide fused to Citrine, under control of MUM4_1.5kb promoterDepositorInsertsignal peptide sequence from basic chitinase
UseTagsCitrine YFPExpressionPlantMutationPromoter1.5 kb MUM4 promoterAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJF439_PU6_empty_sgRNAscaffold - sgRNA cloning backbone
Plasmid#164266PurposesgRNA cloning backbone for expression of sgRNA in C. elegans. Contains BbsI sites for insertion of spacer sequences. U6 promoter from W05B2.8 gene.DepositorTypeEmpty backboneUseCRISPRTagsExpressionWormMutationPromoterU6 promoter from W05B2.8Available sinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK300
Plasmid#87766Purposeempty control plasmid, three terminators to place inserts between for insulation, ampR, pBR322 origin, lacIDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterNoneAvailable sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEBB-3XMyc-TRAF2 S11A
Plasmid#44105DepositorInsertTRAF2 S11A (TRAF2 Human)
UseTags3xMycExpressionMammalianMutationSerine 11 to AlaninePromoterAvailable sinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-mCherry
Plasmid#66533PurposeExpresses mCherry under the control of Mutant T7 Promoter G6DepositorInsertmCherry
UseSynthetic BiologyTagsExpressionBacterialMutationCodon Optimized for E. coliPromoterMutant T7 Promoter - G6Available sinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3_4xUAS_CP-candidate_luc+
Plasmid#125154PurposeSTAP-seq luciferase validation vector, which harbors an 4x UAS array upstream of the CP position (candidates are inserted at CP position) for the recruitement of GAL4-DBD tagged proteinsDepositorInsert4 x upstream activating sequence (UAS)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha11_SulR
Plasmid#186424Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter; suitable for quintuple assemblyDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …TagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70LacZ3-Pcsd-LacZ
Plasmid#191619PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), Pcsd promoter-lacZ, E. lenta constitutive promoterDepositorInsertlacZ
UseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only