-
Plasmid#102833PurposeBinary vector containing Sr22 Schomburgk allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorInsertSr22 Schomburgk (NEWENTRY Synthetic)
UseTagsExpressionPlantMutationPromoterMaize ubiquitinAvailable sinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO-1: shALAS-1
Plasmid#22750DepositorInsertshALAS-1 (Alas1 Mouse)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack: shRev-Erbalpha
Plasmid#22749DepositorInsertshRev-Erbalpha (Nr1d1 Mouse)
UseAdenoviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceJune 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
TFORF1510
Plasmid#144365PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertSTAT5A (STAT5A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.1
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1A
Plasmid#196679PurposeRep/Cap plasmid for the production of MDV1A, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRSVGSVY insert between amino acids 588 and 589 of…Promoterp41Available sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-pCR
Plasmid#46369DepositorInsertcalretinin promoter (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMutationpromoterPromoterAvailable sinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
UseTagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
HEL binding scFv D44.1
Plasmid#111718PurposeYeast Surface Display of D44.1 as a reference starting point for designDepositorInsertD44.1
UseTagscmyc tagExpressionYeastMutationPromoterAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-1
Plasmid#8878DepositorInsertHox A9 (HOXA9 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_PIG_3XHA-Ago1
Plasmid#170916PurposeExpresses 3X-HA-AGO1DepositorInsertAgo1 (Ago1 Mouse)
UseTags3X-HAExpressionMammalianMutationPromoterAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-3
Plasmid#8880DepositorInsertHox A9 (HOXA9 Human)
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 C548A
Plasmid#126592PurposeExpresses siRNA resistant SENP2 (catalytic dead) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationC548APromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only