Showing: 3781 - 3800 of 20560 results
-
Plasmid#72247PurposeHuman expression plasmid for SpCas9-HF1 variant: CMV-T7-humanSpCas9-HF1(N497A, R661A, Q695A, Q926A)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 HF1(N497A/R661A/Q695A/Q926A)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A and Q926APromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
BPK2797
Plasmid#72251PurposeHuman expression plasmid for SpCas9-VRQR variant: CMV-T7-humanSpCas9-VRQR(D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 VRQR(D1135V/G1218R/R1335Q/T1337R)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335Q, and T1337RPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
MSP2372
Plasmid#73196PurposeHuman expression plasmid for SpCas9(R661A/Q695A/Q926A) variant: CMV-T7-humanSpCas9(R661A, Q695A, Q926A)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (R661A/Q695A/Q926A)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationR661A, Q695A, and Q926A in SpCas9PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-P2A-EGFP (RTW3027)
Plasmid#139987PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationPromoterCMV and T7AvailabilityAcademic Institutions and Nonprofits only -
p46Cpf1-OP2
Plasmid#98592PurposeProduces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli.DepositorInsertFnCpf1
UseCRISPRTagsExpressionBacterialMutationCodon optimized for E. coliPromoteraraBADAvailabilityAcademic Institutions and Nonprofits only -
B52 (empty plasmid backbone to express 2 sgRNAs)
Plasmid#100708PurposeEmpty plasmid backbone to express 2 sgRNAs (use BbsI and BsmBI for cloning)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailabilityAcademic Institutions and Nonprofits only -
PX458_AHR_1
Plasmid#101076PurposeEncodes gRNA for 3' target of human AHRDepositorInsertgRNA against AHR (AHR Human)
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
PX458_AHR_2
Plasmid#101077PurposeEncodes gRNA for 3' target of human AHRDepositorInsertgRNA against AHR (AHR Human)
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
-
Showing: 3781 - 3800 of 20560 results